BME494 Sp2014 Tran: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Joey Tran (talk | contribs)
No edit summary
Joey Tran (talk | contribs)
No edit summary
Line 308: Line 308:
This group does not understand the scientific basis for the malarial biosensor but also does not support further research or production of it either. Media sensationalists often use synthetic biology to instill fear and create worry about the controllability of synthetic biological systems. Many of the stories told by sensational media have no bounds in reality. People who also have ethical or moral quandaries with biological interference would also fall into this group, as they disagree with tampering with the natural state of biological systems. <br><br>
This group does not understand the scientific basis for the malarial biosensor but also does not support further research or production of it either. Media sensationalists often use synthetic biology to instill fear and create worry about the controllability of synthetic biological systems. Many of the stories told by sensational media have no bounds in reality. People who also have ethical or moral quandaries with biological interference would also fall into this group, as they disagree with tampering with the natural state of biological systems. <br><br>


 
[[Image:BME494_HaiTran_stakeholders.PNG|520px|center]]


<!--Wait until Unit 3 to fill this in. Demonstrate that you have considered the societal aspects of your project. -->
<!--Wait until Unit 3 to fill this in. Demonstrate that you have considered the societal aspects of your project. -->
Line 329: Line 329:
<br>
<br>


==WORKS CITED==
==References==
1. "CDC Malaria". http://www.cdc.gov/malaria/index.html<br>
1. "CDC Malaria". http://www.cdc.gov/malaria/index.html<br>
2. "WHO | Malaria". http://www.who.int/mediacentre/factsheets/fs094/en/<br>
2. "WHO | Malaria". http://www.who.int/mediacentre/factsheets/fs094/en/<br>

Revision as of 22:49, 22 April 2014


My Profile       Dr. Haynes       OpenWetWare       Previous Course       Wiki Editing Help      


Background & Proposed Application

BACKGROUND

The malarial biosensor is modeled after the classical synthetic toggle switch developed in Escherichia coli, or E. Coli (Gardner et al 2000). The precedent synthetic system was developed with two different inducible states, an “on” and “off” state. The system was created using two promoter and repressor pairs. Both repressors are inhibited by a different inducer (aTc and IPTG). The promoters were placed upstream of the repressor gene of the opposite pair. This created a bistable system where only one promoter would be expressed at any one time, since the expression of a promoter repressed expression of the other promoter. To distinguish a cell between its on and off state, a green fluorescence protein transcription gene was placed downstream of the on state promoter.

Topological overview of classical synthetic device from Gardner et al, 2000.


APPLICATION OF MY PROPOSED NEW DEVICE

Malaria is a disease caused by any one of five different species of plasmodium, including P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowles. The life cycle of these plasmodium consist three different phase. During one phase, the plasmodium reproduces within a female mosquito. When the mosquito takes a blood meal from a human, the saliva of the mosquito, abundant with the pathogen, transfers the disease into the new human host. From there, the parasite infects and multiplies inside of liver and blood cells.

The World Health Organization estimated that malaria was responsible for approximately 207 million clinical episodes and more than 600,000 deaths. More than 90% of fatal cases of malaria originate in Africa.

Malaria presents itself with fever, sweats, chills, and other symptoms commonly associated with a common cold. When discovered early, malaria has a low mortality rate and can be readily treated. Unfortunately, because malarial symptoms can be difficult to recognize, diagnosing malaria can often be an arduous task.

Currently, the most widely and accepted standard for diagnosis consists of microsopy. Microscopy techniques consist of taking a drop of a patient’s blood and staining it with a dye that gives plasmodium a distinct appearance. The drop is then examined under microscope for the presence of these dyed plasmodium. Microscopy is the most reliable method of diagnosis but requires quality reagents, microscopes, and an experienced lab technician. Generally, microscopy requires travel to an apt-equipped facility with the proper equipment which is not always a possibility.

Another widely used method of diagnoses is Rapid Diagnostic Tests (RDTs). RDTs test a patient's blood for the presence of malaria related antigens. The fallback to RDTs though are they still need to be improved for accuracy, often require the use of a clinician, and can be costly.

The proposed device hopes to remedy the problem of diagnosing malaria in remote areas and rural communities which do not have access to advanced tools such as microscopes. If successful, the device will be placed into small kits which would be used to test a drop of the patient’s blood and results would be readable within the day. The kit would designed to be easy to use so rural communities without experienced clinicians could still have a preliminary means of diagnosing malaria.



Design of a New Device

The device will be designed as a diagnostic tool for malaria. Studies have shown that malaria often presents itself with a higher concentration of copper in the bloodstream (Iqbal, 2000). The proposed device will capitalize on this correlation and use copper as an input.

Similar to Gardner’s classical device, will use two promoter-repressor pairs in order to establish a bistable system. The key difference between the proposed device and Gardner’s device is that the “on” state of the system in which green fluorescence is expressed will be induced by the presence of excess copper.

Topological diagram of device. "On" state induced by presence of copper. "Off" state on constitutively and reinduced by aTc.
Topological diagram of device. "On" state induced by presence of copper. "Off" state on constitutively and reinduced by aTc.

Topological diagram of device. "On" state induced by presence of copper. "Off" state on constitutively and reinduced by aTc.

Tetracycline Promoter
Biobrick: Bba_ R0040
This component will be the promoter used during the “off” state of the device. It has a constitutive transcription rate in order to ensure that the device will begin in the “off” state and will only express green fluorescence when the device is switched “on”. This promoter will also be repressed from the expression of tetracycline repressor, which is expressed in the “on” state of the device.

Lac Repressor
Biobrick: Bba_K292005
This gene will be expressed when the tetracycline promoter, and will repress expression of the lac promoter utilized in the “on” state of the system. This component is essential to the bistability of the device since its expression prevents the expression of the “on” state promoter.

Copper Promoter
Biobrick: Bba_I760005
This transcriptional unit is responsible for the expression of the “on” state genes. This promoter will be induced by excess extracellular copper concentration through the cusR / cusS cell signal pathway. In this signaling pathway, the transmembrane protein cusS reacts to excess extracellular copper concentration and phosphorylates cusR which is a transcription factor for this promoter. The promoter will then, theoretically, promote the transcription of tetracycline repressor and green fluorescence protein, indicating the “on” state. The sensitivity of this promoter is paramount to the success of the device. During testing of the device, the promoter must be sensitive to a certain concentration of copper, as related to the presence of malaria. If the promoter is unsuccessful, other copper pathways in the E. coli can be explored for different copper sensitive promoters.

Lac Promoter
Biobrick: Bba_R0010
The Lac promoter is still used in this device in order to introduce a repressible element to the “on” state genes. The Lac repressor gene expressed through the tetracycline promoter in the “off” state pathway will repress this promoter, ensuring tetracycline repressor and green fluorescence protein are not expressed.

Green Fluorescence Protein
Biobrick: Bba_K823039
Green fluorescence protein is used as the reporter for this device. Because the gene for transcription of green fluorescence protein is placed downstream of the copper promoter, the green fluorescence will indicate the presence of excess copper and subsequently, the presence of malaria.

AmpR Vector Backbone
Biobrick: pSB1A3
This ampicillin resistant vector will be used to host the other device components. It surrounds the input area with terminators in order to prevent transcription outside of the input area.



Building the New Device

The malarial biosensor will be constructed with a series of Biobricks which have already been created and can be found in the iGEM registry. All of the components of the system will be assembled together in a specific order through use of the Type IIS Assembly process, which utilizes BsmBI enzymes and cleavage sites.

SYNTHETIC DNA LAYOUT

The device consist of a lac promoter-repressor pair and a tetracycline promoter-repressor pair. The lac repressor gene will be placed downstream of the tetracycline promoter. Next to the tetracycline promoter will be a copper induced promoter followed by the lac promoter, tetracycline repressor, and green fluorescence protein genes, all of which will have a reversed transcriptionally to the lac repressor and tetracycline promoter genes. These genes will be placed into a a pSB1A3 vector, which carries ampicillin resistance and surrounds the input area of the gene with terminators to prevent transcription out of the desired area.

Topological diagram of device. "On" state induced by presence of copper. "Off" state on constitutively and reinduced by aTc.
Topological diagram of device. "On" state induced by presence of copper. "Off" state on constitutively and reinduced by aTc.


RESOURCES The following Biobricks will be used to construct the malarial biosensor, all of which can be found in the iGEM registry.

Biobricks for Malarial Biosensor
Name ID Length
Lac Promoter Bba_ R0040 200 bp
Tet Promoter Bba_ R0040 54 bp
RBS + Tet Repressor Bba_S03518 703 bp
Lac Repressor Bba_K292005 1256 bp
Kozak RBS BBa_J176012 18 bp
Copper Promoter BBa_I760005 16 bp
Green Fluorescence Protein Bba_K823039 845 bp
AmpR Vector Backbone pSB1A3 2155 bp

TYPE IIS ASSEMBLY

PCR

Each desired DNA part used for the device will be amplified through polymerase chain reaction (PCR). PCR is performed by adding primers complementary to the desired DNA components. The DNA components are then heated in order to denature the DNA into single strands. The temperature is then lowered so the complementary primers will then anneal to the single strands. These primers will then be elongated by DNA polymerase. The cycle is then repeated a multitude of times, resulting in an exponential production of the desired DNA part.

Digestion Ligation Reaction

The digestion ligation reaction which Type IIS Assembly is based on consists of using a Type II restriction enzyme, BsmBI, which binds to a specific sequence of DNA and cleaves a certain number of base pairs away. This leaves a “sticky overhang” which can be designed to complement the “sticky overhang” of another component DNA part. Primers are used in order to introduce these cleavage and complementary sites to the DNA components. Once all of the cleavage and complementary sites have been introduced, the BsmBI restriction enzyme is mixed with the DNA components and the parts will naturally digest and ligase into the synthetic system.


Primers
The following primers will be used to introduce complementary overhangs and BsmBl cleavage sites.

pSB1A3 Forward Primer – cacaccaCGTCTA actagtagcggccgctgcag
Reverse Primer – cacaccaCGTCT atctagaagcggccgcgaattcc
lacI Forward Primer – cacaccaCGTCTCa taga atggtgaatgtgaaa
Reverse Primer - cacaccaCGTCTa cggg aaataataaaaaagc
RBS Forward Primer – cacaccaCGTCTa cccgccgccaccatg
Reverse Primer – cacaccaCGTCTa ggga ctccatggtggcggc
Ptet Forward Primer – cacaccaCGTCTa tccctatcagtgata
Reverse Primer – cacaccaCGTCTa attg gtgctcagtatctct
Plac Forward Primer – cacaccaCGTCTa caatacgcaaaccgc
Reverse Primer – cacaccaCGTCTa cttt tgtgtgaaattgtta
tetR Forward Primer – cacaccaCGTCTa aaagaggagaaatac
Reverse Primer – cacaccaCGTCTa cggg gtgatctacactagc
RBS Forward Primer – cacaccaCGTCTa cccgccgccaccat
Reverse Primer – cacaccaCGTCTa caga ctccatggtggcggc
GFP Forward Primer – cacaccaCGTCTa tctgaggtcattact
Reverse Primer – cacaccaCGTCTa tagt atgcgtaaaggagaa
Ptcu Forward Primer - cacaccaCGTCTa atgacaaaattgtca
Reverse Primer - cacaccaCGTCTCa ggga atgacaattttgtca

Reagents and Procedures
For PCR, the general reagents needed are as listed:

PCR Reagents
Reagent Volume
Template DNA 0.2 μL
1.0 uM Forward Primer 1.0 μL
1.0 uM Reverse Primer 1.0 μL
2x GoTaq Green Mix 25 μL
H2O 22.8 μL
TOTAL VOLUME 50 μL

The reagents will be mixed and then thermal cycled as follows:
95°C, 3 min.
[95°C, 15 sec; 55°C, 15 sec; 72°C, 30 sec] x30
72°C/ 3 min.
4°C/ ∞

For the digestion-ligation reaction, these reagents will be used:

Digestion-Ligation Reagents
Reagent Assembly Negative Control
pSB1A3 (vector) 1.0 μL 1.0 μL
Tet Promoter 1.0 μL None
RBS + Tet Repressor 1.0 μL None
Lac Promoter 1.0 μL None
Lac Repressor 1.0 μL None
GFP 1.0 μL None
Kozak 1.0 μL None
10x T4 Ligase Buffer 1.0 μL None
T4 Ligase 1.0 μL None
BsmBI 0.5 μL None
H2O 0.5 μL None
TOTAL VOLUME 10 μL 1 μL

These reagents will then be mixed and thermal cycled as follows:
[45°C, 2 min.; 16°C, 5 min.] x25
60°C, 10 min.
80°C, 20 min.
4°C, ∞

Testing the New Device

LAC OPERON MODEL SIMULATION
I used a model of the natural Lac operon to learn how changing the parameter values changes the behavior of the system.


RELATIONSHIP BETWEEN THE LAC MODEL AND MY NEW DESIGN
I used a model of the natural Lac operon to learn how changing the parameter values changes the behavior of the system. At concentrations of 0.25M IPTG, the mathematical model showed that mRNA concentration decreased and established an equilibrium point beneath the initial concentration of mRNA. At concentrations of 0.35M and higher IPTG, mRNA concentration increased over time and established an equilibrium point above its initial concentration. Bgal increased its concentration over time for all concentrations of IPTG. The higher the concentration of IPTG, the higher the equilibrium concentration of Bgal.

Similarities: The Lac operon model is useful because it relates to the Tet operon and can be used to infer how aTc affects the transcription rate of the tet promoter. Furthermore, the model can be used to better understand how the lac promoter and lac repressor genes will react with one another inside the biosensor system.

Differences: Unfortunately, the lac operon model cannot be used to gleam exact tet promoter reactions to different concentrations of aTc. Furthermore, the Lac operon model does not explore the most critical component of the malarial biosensor, which is the effect of copper concentration on the copper promoter. This is a paramount parameter to explore since the reaction of the copper promoter is paramount to the viability of the device.


TESTING THE NEW DEVICE

This device’s performance can be tested by exposing colonies with the device to different concentrations of copper. Flow cytometry and microscopy can then be used to retrieve values of fluorescence from the exposed colonies. If the device is successful, then copper concentrations similar to those found in malaria infected patients will cause the device to fluoresce green, while lower copper concentrations will have no effect on the cells and their appearance.

Human Practices - Stakeholder Assessment



SUPPORTS AND UNDERSTANDS
This demographic consists of people who understand the scientific basis for the device and continue to support it. This group understands the relatively low risk of using E. coli as a chassis and understands the relatively low risk in establishing a gene system within it. This group would mostly be made up of people with scientific backgrounds, such as scientists, doctors, and biologists. All of these professions would most likely understand the background for the device and support it for its potential which far outweighs its risks.

DOES NOT SUPPORT BUT UNDERSTANDS
These people understand the scientific basis for the malarial biosensor like the aforementioned group but they do not support it. This can be made up of competition, such as producers of Rapid Diagnostic Tests or microscopes for diagnostic microscopy. This group can also be made up of fearful people with scientific backgrounds who believe that the use of E. coli can have dangerous and unforeseeable effects.

SUPPORTS BUT DOES NOT UNDERSTAND
This group is made up of people who support the research and production of a malarial biosensor as a new and novel diagnostic tool but does not understand the scientific basis from which it is made. People who would fall in this group would most likely be humanitarians who understand the need for a cheaper rural diagnostic tool. Potential patients would also fall in this group, as they would support the production of a new and cheaper means of diagnoses and treatment of malaria.

DOES NOT SUPPORT NOR UNDERSTANDS
This group does not understand the scientific basis for the malarial biosensor but also does not support further research or production of it either. Media sensationalists often use synthetic biology to instill fear and create worry about the controllability of synthetic biological systems. Many of the stories told by sensational media have no bounds in reality. People who also have ethical or moral quandaries with biological interference would also fall into this group, as they disagree with tampering with the natural state of biological systems.



About the Designer

Your Name


  • My name is Hai Joey Tran, and I am a freshman majoring in biomedical engineering. I am taking BME 494 because I love the combination of medicine and mathematics. An interesting fact about me is that I do motor cortical research down at Barrow Neurological Institute.



References

1. "CDC Malaria". http://www.cdc.gov/malaria/index.html
2. "WHO | Malaria". http://www.who.int/mediacentre/factsheets/fs094/en/
3. "Haynes:TypeIIS Assembly". http://openwetware.org/wiki/Haynes:TypeIIS_Assembly
4. Gardner T.S., Cantor C.Reverse, Collins J.J. 2000. Nature. Vol 409: 339-342 5. Iqbal J., Sher A., Rab A., 2000. Journal of Microbiology. Vol 38: 1184-1186