Gene Synthesis from Oligonucleotides
Templateless PCR
Our goal in this session is to assemble the GFP gene from small pieces of DNA ~60 nucleotides long (called oligonucleotides or oligos). We use templateless PCR (also called Polymerase Cycling Assembly or Assembly PCR) to assemble the oligonucleotides into the full-length GFP gene. While this method effectively assembles the gene, it produces a relatively low yield of the full-length gene and many smaller fragments will also be produced. The Wikipedia site offers a useful introduction to polymerase cycling assembly: [1]
- Before you set up reactions, make sure you reserve a spot in the PCR machine.
- Set up your reactions on ice. Keep nucleotides and master mix on ice AT ALL TIMES!
- Be sure that each reagent is well mixed by pipetting up and down several times before using
You will be performing 3 reactions:
- Assembly of the GFP gene
- A positive control reaction (a reaction that we know should produce large amounts of DNA)
- A negative control reaction (a reaction that contains no input DNA and therefore should not produce any DNA; this is a check for contaminating DNA)
Procedure:
1. Obtain 3 PCR tubes (these are the small thin-walled tubes). Label the tubes 1-3.
2. To each tube, add the components listed below.
| Assembly reaction | Positive control reaction | Negative control reaction | |
| PCR master mix (buffer and enzyme) | 10 ul | 10 ul | 10 ul |
| Nucleotides (1.25 mM) | 5 ul | 5 ul | 5 ul |
| Oligos | 5 ul of assembly oligos | 5 ul of control oligos | 5 ul of control oligos |
| DNA template | 5 ul of water | 5 ul of control template | 5 ul of water |
| Total | 25 ul | 25 ul | 25 ul |
3. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate.
4. Place your tubes in the PCR machine in the position for which you signed up. Make sure that you have recorded which sample is in each position in the PCR machine.
Reaction Conditions:
1 cycle:
94oC, 3 minutes
5 cycles:
94oC, 30 seconds
69oC, 30 seconds
72oC, 1 minute
5 cycles:
94oC, 30 seconds
65oC, 30 seconds
72oC, 1 minute
20 cycles:
94oC, 30 seconds
61oC, 30 seconds
72oC, 1 minute
1 cycle:
72oC, 3 minutes
While the reactions are being performed, you can proceed to setting up the Finish PCR reactions.
Finish PCR
Templateless PCR produces a relatively low yield of the full-length gene; many smaller fragments that did not complete assembly are also produced. The goal of PCR is to exponentially amplify a template DNA sequence to increase its abundance (A good introduction to PCR is here: [2]. The goal of finish PCR is to exponentially amplify the full-length gene that was assembled by templateless PCR. The result is that most of the DNA present in the reaction mixture following finish PCR will be the full-length gene.
- Set up your reactions on ice. Keep nucleotides and master mix on ice AT ALL TIMES!
- Be sure that each reagent is well mixed by pipetting up and down several times before using
You will be performing 3 reactions:
1. Amplification of the GFP gene
2. A positive control reaction (a reaction that we know should produce large amounts of DNA)
3. A negative control reaction (a reaction that contains no input DNA and therefore should not produce any DNA; this is a check for contaminating DNA)
Procedure:
1. Obtain 3 PCR tubes (these are the small thin-walled tubes). Label the tubes 1-3.
2. To each tube, add the components listed below. You will need to wait until the templateless PCR reactions have completed to add the GFP template.
| Amplification of GFP gene | Positive control reaction | Negative control reaction | |
| PCR master mix (buffer and enzyme) | 10 ul | 10 ul | 10 ul |
| Nucleotides (1.25 mM) | 5 ul | 5 ul | 5 ul |
| Oligos | 5 ul of amplification oligos | 5 ul of control oligos | 5 ul of control oligos |
| DNA template | 5 ul of GFP template | 5 ul of PC template | 5 ul of water |
| Total | 25 ul | 25 ul | 25 ul |
3. Once the templateless PCR reactions have finished, obtain a 1.7 ml microcentrifuge tube. Label tube with you initials and “T-PCR NC”. Transfer the liquid from tube 3 of your templateless PCR (the negative control) to this tube and put it away to be used in two weeks.
4. Obtain a 1.7 ml microcentrifuge tube. Label tube with your initials and “T-PCR PC”. Transfer the liquid from tube 2 of your templateless PCR (the positive control) to this tube and put it away to be used in two weeks.
5. Obtain a 1.7 ml microcentrifuge tube. Label tube with your initials and “GFP template”. Transfer the liquid from tube 1 of your templateless PCR (the assembly of the GFP gene) to this tube. To this tube, add 180 ul of water. Mix well and use 5 ul of this mixture as the DNA template for Finish PCR reaction 1 according to the table above.
6. Cap your tubes and make sure that they are sealed tightly so that the liquid will not evaporate.
7. Place your tubes in the PCR machine in the position for which you signed up. Make sure that you have recorded which sample is in each position in the PCR machine.
Reaction Conditions:
1 cycle:
94oC, 3 minutes
35 cycles:
94oC, 30 seconds
55oC, 30 seconds
72oC, 1 minute
1 cycle:
72oC, 3 minutes
Designing oligos for gene assembly
Our goal is to build the GFP (green fluorescent protein) gene, which codes for the GFP protein, which makes cells glow green. To create GFP by templateless PCR, we must first break our sequence into oligonucleotides (oligos). To design the GFP oligos, we will use a program called Gene Design, available at: [3].
Step 1: To begin, we start with the sequence of GFP. ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTCGTGACCACCTTGACCTACGGCGTGCAGTGCTTCGCCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGAC CCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAGGTCTATATCACCGCCGACAAGCAGAAGAACGGCATCAAG GTGAACTTCAAGACCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGAGCTGTACAAGTAA;
http://openwetware.org/skins/common/images/button_bold.png
Step 2: Rather than ordering one piece of DNA that is the length of our gene (~750 bp), we order our DNA as oligonucleotides of approximately 60 bp. From the GeneDesign homepage, click “Building Block Design (restriction site overlap)”.
Make sure the settings are:
- “Target oligo length” of 60 bp
- “Overlap melting temperature” of 56deg
- Make sure that “generate gapped oligos” is selected
- Make sure that “maximum allowable oligo length” is set to 60
Click “Design oligos”. Notice that in the second white box at the top you see four DNA strands: the top and bottom strands are the two complete strands of the final assembled gene and in between them you see the overlapping oligos that can be used to synthesize the gene.
Step 3: Redesign the GFP gene. Before we begin to synthesize the gene in the lab, we can change or re-design the gene in several ways to make it different from the natural sequence. As an example, we will recode the gene by changing the DNA sequence that encodes the GFP protein. To re-design GFP, we will use a program called Gene Design, available at www.genedesign.org
Click on “Design a Gene”. Enter the amino acid sequence of GFP from above.
Click on “E. coli” and then “Reverse Translate”. You should get a nucleotide sequence as an output from the program. This nucleotide sequence now uses the preferred codons of E. coli to encode GFP.
Step 4: Breaking the DNA sequence into overlapping oligonucleotides. Rather than ordering one piece of DNA that is the length of our gene (750 bp), we order our DNA as oligonucleotides of approximately 60 bp. Click “BB Design (Sequence overlap)”.
- Make sure the settings are at “Target oligo length” of 60 bp and “overlap melting temperature” of 56deg.
- Make sure that “generate gapped oligos” is selected.
- Click “Design building blocks”. Notice that in the white box at the top you see four DNA strands: the top and bottom strands are the two complete strands of the building block and in between them you see the overlapping oligos that can be used to synthesize the building block.
Step 5: Click “FASTA format: Assembly oligos” and the program will provide you with a list of the oligos that can be used to synthesize your designed GFP gene. These oligos have been ordered from a commercial DNA synthesis company and have been combined together to create the assembly oligos that we used in the templateless PCR.