User:Corey Bear/Notebook/(22 July 2014) DNA Sequence of Transect

From OpenWetWare
Revision as of 21:58, 23 July 2014 by Corey Bear (talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search

Intent: The intent of this experiment was to learn and understand the diversity and complexity of DNA structures found within the transect.

Overview: This experiment involved two major sub-processes that solidified the circle of life present in the American University Farm transect site. The first process was to visit a DNA website that helped depict and identified processed DNA—link below— further enabling a genetic analysis of the transect. While analysis was capable through broad online resources, the actual DNA data obtained from the transact was corrupted during the PCR. Information regarding the DNA structures found in the transect, which can be found in the Observation section of this report, are derived from previous student would were capable of completing the PCR without error. The second process to this experiment was to search, analyze, and report on findings found within previous students’ Openwetware regarding DNA from the same transept site.

Observations: The DNA sequence that was analyzed in support of the farm transect was derived from other sources that had previously conducted a 16S DNA PCR. The sequence, which can be found below, is a 206 character long code. (Morgulis, et al, 2014) This sequence is found in over 1000 different organisms, ranging from Chryseobacterium Shigense sp., Flavobacteriaceae, and Chryseobacterium. This DNA is mainly found in bacteria matter, and is most likely prevalent throughout the transect site. Chryseobacterium Shigense sp, which is the specific DNA that has been BLASTED, is a yellow-pigmented, aerobic bacterium, which was isolated from lactic acid. It is aerobic in nature and acts as a chemo-organotrophic. Data before this point is inconclusive, and therefore the comparison of DNA sequences is limited. It is predicted though, that these bacteria are present throughout the transect, as they provide aerobic and chemo-organotrophic support to other organisms. Moreover, these DNA sequences are most likely stable, as they are present in one of the three domains of life, bacteria. (Bentley, et al, 2014)

This phylogenetic tree illustrates the sequence connections found from within the transact, to other bacterium and organisms seen throughout the world. (Morgulis, et al, 2014)


Website for DNA BLAST:' http://blast.ncbi.nlm.nih.gov/Blast.cgi#alnHdr_385866652


DNA Sequence provided:

AAGATTAATACCCCATAATATTTTAAGTGGCATCACTTGAAATNGAAAACTCCGGTGGATAAAGATGGGCACGCTCAAGATTAGATAGTTGGTAGGGTAACGGCCTACCAAGTCTACGATCTTTAGGGGGCCTGANAGGGTGATCCCCCACACTGGTACTGAGACACGGACCANACTCCTACGGTAGGATCAGTGAGGAATATT


Reference

Bentley., Walters-Conte., & Zeller. (2014). Biology 210 Lab Manual. Washington: American University.

Morgulis A, Coulouris G, Yan Raytselis, Madden T,Agarwala R, and Schäffer A. [2008]. Database Indexing for Production MegaBLAST Searches. Bioinformatics 24:1757-1764. Available from http://blast.ncbi.nlm.nih.gov/Blast.cgi