Biomod/2014/ASU/Materials
<html xmlns="http://www.w3.org/1999/xhtml" xmlns:v="urn:schemas-microsoft-com:vml" xml:lang="en" lang="en" dir="ltr">
<head>
<title>Nanodevils - OpenWetWare</title>
<style type="text/css" media="screen, projection">/*<![CDATA[*/
@import "/skins/common/shared.css?164";
@import "/skins/monobook/main.css?164";
/*]]>*/</style>
<link rel="stylesheet" type="text/css" media="print" href="/skins/common/commonPrint.css?164" />
<script type= "text/javascript">/*<![CDATA[*/
var skin = "monobook";
var stylepath = "/skins";
var wgArticlePath = "/wiki/$1";
var wgScriptPath = "";
var wgScript = "/index.php";
var wgVariantArticlePath = false;
var wgActionPaths = [];
var wgServer = "http://openwetware.org";
var wgCanonicalNamespace = "";
var wgCanonicalSpecialPageName = false;
var wgNamespaceNumber = 0;
var wgPageName = "Biomod/2014/ASU";
var wgTitle = "Biomod/2014/ASU";
var wgAction = "view";
var wgArticleId = "136275";
var wgIsArticle = true;
var wgUserName = null;
var wgUserGroups = null;
var wgUserLanguage = "en";
var wgContentLanguage = "en";
var wgBreakFrames = false;
var wgCurRevisionId = "750826";
var wgVersion = "1.13.2";
var wgEnableAPI = true;
var wgEnableWriteAPI = false;
var wgMWSuggestTemplate = "http://openwetware.org/api.php?action=opensearch\x26search={searchTerms}\x26namespace={namespaces}";
var wgDBname = "owwdb";
var wgSearchNamespaces = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 100, 101, 110, 111];
var wgMWSuggestMessages = ["with suggestions", "no suggestions"];
var wgRestrictionEdit = [];
var wgRestrictionMove = [];
/*]]>*/</script>
<script type="text/javascript" src="/skins/common/wikibits.js?164"></script>
<script type="text/javascript" src="/skins/common/ajax.js?164"></script>
<script type="text/javascript" src="/ext/AjaxShowEditors/AjaxShowEditors.js"></script>
<script type="text/javascript" src="/skins/common/mwsuggest.js?164"></script>
<script type="text/javascript" src="/index.php?title=-&action=raw&gen=js&useskin=monobook"></script>
<style type="text/css">/*<![CDATA[*/
@import "/index.php?title=MediaWiki:Common.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000";
@import "/index.php?title=MediaWiki:Monobook.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000";
@import "/index.php?title=-&action=raw&gen=css&maxage=18000&useskin=monobook";
/*]]>*/</style>
</head>
<body class="mediawiki ns-0 ltr page-Biomod_2014_ASU">
<a name="top" id="top"></a>
Biomod/2014/ASU
From OpenWetWare
< <a href="/wiki/Biomod" title="Biomod">Biomod</a> | <a href="/wiki/Biomod/2014" title="Biomod/2014">2014</a>
<link rel="stylesheet" href="http://fonts.googleapis.com/css?family=Lato:300,100&subset=latin">
<script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.2/jquery.min.js" ></script>
<script type"text/javascript">
$(function () {
$("style[media*='screen']").remove();
$("link[href*='favicon']").remove();
//fix heading
var h1 = $(".firstHeading").text().split("/");
$(".firstHeading").text(h1[h1.length-1]);
$("tr:odd").addClass("odd");
});
</script>
<style type="text/css">
/**** Base styles ****/
- column-one, #footer, div#sidebar-main, #contentSub, .firstHeading, #siteSub, #jump-to-nav, .printfooter{
display: none;
}
- content {
margin: 0;
padding: 0;
background: #fff;
border: none;
}
html, body, div, span, object, iframe,
h1, h2, h3, h4, h5, h6, p, blockquote, pre,
abbr, address, cite, code, del, dfn, em, img, ins, kbd, q, samp,
small, strong, sub, sup, var, b, i, dl, dt, dd, ol, ul, li,
fieldset, form, label, legend,
table, caption, tbody, tfoot, thead, tr, th, td,
article, aside, canvas, details, figcaption, figure,
footer, header, hgroup, menu, nav, section, summary,
time, mark, audio, video {
margin: 0;
padding: 0;
border: 0;
font: inherit;
}
article, aside, details, figcaption, figure,
footer, header, hgroup, menu, nav, section {
display: block;
}
body {
/*padding: 15px;*/
font-family: 'Lato', 'Lucida Sans Regular', 'Lucida Grande', 'Lucida Sans Unicode', Arial, sans-serif;
font-size: 2rem;
font-weight: 200;
line-height: 1.4;
background: #fff;
color: #000000;
max-width: 1280px;
padding-top: 55px;
margin-left: auto;
margin-right: auto;
}
}
h1, h2, h3, p, ul, ol, pre, dl {
font-weight: 100;
}
h1, h2, #super-list, .box, .tagline, #index-list {
font-family: 'Lato', 'Helvetica Neue', Arial, sans-serif;
}
h1, h2, h3 { font-weight: 300; }
h1 {
font-size: 16px;
line-height: 1.1em;
}
h2 {
font-size: 22px;
}
a,
a code {
color: #FB4;
text-decoration: none;
}
a:hover,
a:hover code {
color: #FFCC00;
}
a:active,
a:active code {
color: #000000;
/*background: black;*/
}
a img { border: none; }
a.anchor{display: block; position: relative; visibility: hidden;}
p{
text-align:left;
}
em { color: #00EF00; }
strong { font-weight: bold; }
blockquote {
padding-left: 1.0em;
margin-left: 1.0em;
border-left: 1px solid #333;
font-style: italic;
}
nav {
background: rgba(25, 25, 25, 0.85);
padding: 0px;
position: fixed;
top: 0px;
left: 0px;
bottom: 0px;
right: 0px;
z-index: 100;
}
nav ul {
width: 100%;
margin: 0px auto;
padding: 0px;
list-style-type: none;
}
nav ul li {
float: left;
line-height:2.5;
}
nav ul li.selected {
border-bottom: solid 10px #580000;
}
nav ul li.home {
padding: 0px;
}
nav ul a {
float: left;
text-decoration: none;
color: #F2F2F2;
text-transform: uppercase;
font-size: 20px;
font-weight: 300;
padding: 0px 20px 0;
}
- content {
margin-top: 60px;
}
- filters > li{
margin: 0px;
display: inline-block;
}
.box.clickable:hover{
background: none repeat scroll 0 0 #fff;
}
.clickable img {
transition: 0.3s ease;
}
.clickable img:hover {
opacity:0.9;
transition: 0.3s ease;
}
.background {
left: 0;
margin: 0;
max-width: 100%;
padding: 0;
}
/*the boxes*/
.box.b2x2{
height: 300px;
width: 300px;
position: fixed;
}
.box.b2x2 > img{
display: block;
margin-left: auto;
margin-right: auto;
margin-top: 10px;
height: 300px;
width: 300px;
position: fixed;
}
.box.b2x1{
height: 360px;
}
.box.b1x2{
width: 930px;
height: 1500px;
}
.box.b1x3{
width: 700px;
}
/*start page*/
.box.intro { font-size:7.2rem;}
.box > p {
font-size: 16px;
padding: 0 20px;
margin-top: 10px;
text-align: justify;
font-weight: 300;
}
.box > h2 {
font-size: 20px;
font-weight: 100;
text-align:left;
margin-left: 20px;
margin-top: 15px;
}
.tease > h2 {
font-size: 40px;
font-weight: 100;
margin-top: 80px;
}
/*project*/
.project{
background-attachment: fixed;
width: 100%;
padding-bottom: 40px;
}
.project h2 {
color: #FFFFFF;
font-weight: 300;
margin-bottom: 30px;
margin-left: 180px;
padding-top: 20px;
position: relative;
}
.project h3 {
font-size: 26px;
}
.project .box {
margin-bottom: 20px;
margin-top: 0;
}
.interlude{
background: none repeat scroll 0 0 #2A2A2A;
box-shadow: 0 0 25px rgba(0, 0, 0, 0.8);
border: 1px solid rgba(0, 0, 0, 0.3);
height: 150px;
position: relative;
z-index: 3;
}
.interlude *{
float:left;
}
.interlude h2{
color: #FFFFFF;
display: block;
font-weight: 300;
line-height: 150px;
margin-left: 24%;
margin-right: -14%;
width: 50%;
}
.interlude img{
float: left;
line-height: 150px;
margin-left: 10%;
margin-top: 25px;
vertical-align: middle;
}
.clear{
clear: both;
}
.project_box{
background: none repeat scroll 0 0 #FFFFFF;
color: #000000;
display: block;
float: left;
font-size: 18px;
font-weight: 300;
line-height: 1.6;
margin-left: auto;
margin-right: auto;
overflow: hidden;
padding: 10px;
width: 50%;
}
.figure_box{
display: block;
float: left;
margin-left: 20px;
overflow: hidden;
width: 230px;
}
/*se*/
.project_box h2{
color: #1A1A1A;
display: block;
font-weight: 300;
margin-left: 0%;
margin-right: -10%;
width: 90%;
}
.project_box p{
text-align: justify;
margin-bottom: 18px;
}
.project_box li {
margin-left:50px
}
- pb_mot.project_box{
height: 350px;
}
- pb_dna_scaff.project_box{
height: 400px;
}
- pb_dna_req.project_box{
height: 250px;
}
- pb_poly_intro.project_box{
/*right: -20%;*/
height: 200px;
}
- pb_poly_pmoxa.project_box{
/*right: -20%;*/
height: 600px;
width: 1000px;
overflow:scroll;
}
- pb_ir.project_box{
/*right: -20%;*/
height: 1300px;
}
- pb_poly_cp.project_box{
/*right: -20%;*/
height: 600px;
}
/*team page*/
.bio_box {
background: none repeat scroll 0 0 #E74C3C;
float: left;
font-size: 15px;
height: 440px;
padding: 15px;
text-align: justify;
width: 210px;
}
.bio_box > .name{
font-size: 24px;
font-weight: 300;
margin-bottom: 25px;
text-align: center;
width: 100%;
}
.bio_box > p{
text-align: justify;
font-weight: 300;
font-size: 16px;
}
.box.big img{
opacity:1;
}
.flag > *{
float:left;
}
.flag > p{
font-size: 18px;
position: relative;
text-align: center;
top: -6px;
width: 75%;
margin-bottom: 10px;
}
- team .big{
opacity:1;
}
.head{
width:220px;
float:left;
}
/*sponsor page*/
- sponsors .box {
background: none repeat scroll 0 0 white;
}
- sponsors figcaption {
height: 65px;
width: 100%;
font-size: 15px;
font-weight: 300;
top: auto;
bottom: 0;
opacity: 0;
transform: translateY(100%);
transition: transform 0.4s, opacity 0.1s 0.3s;
-webkit-transform: translateY(100%);
-webkit-transition: -webkit-transform 0.4s, opacity 0.1s 0.3s;
}
- sponsors .descr{
background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4);
font-size: 12px;
font-weight: 300;
height: 60px;
margin: 0;
padding-left: 10px;
padding-right: 10px;
padding-top: 10px;
text-align: justify;
top: -155px;
line-height: 1.3;
}
- sponsors .descr p{
width:90%;
margin-left:auto;
margin-right:auto;
}
- sponsors figure.clickable:hover figcaption{
opacity: 1;
transform: translateY(0px);
transition: transform 0.4s, opacity 0.1s;
-webkit-transform: translateY(0px);
-webkit-transition: -webkit-transform 0.4s, opacity 0.1s;
}
- sponsors figure:hover .descr{
opacity: 1;
transform: translateY(155px);
transition: transform 0.4s, opacity 0.1s;
-webkit-transform: translateY(155px);
-webkit-transition: -webkit-transform 0.4s, opacity 0.1s;
}
/*gallery*/
- gallery .box img{
min-height: 220px;
min-width: 220px;
}
/*ptocols*/
.protocol_box{
background: none repeat scroll 0 0 #FFFFFF;
color: #000000;
display: block;
float: left;
font-size: 18px;
font-weight: 300;
line-height: 1.6;
margin-left: 40px;
margin-right: auto;
overflow: hidden;
padding: 10px;
width: 66%;
}
.protocol_box li {
margin-left:50px
}
.protocol_box p{
text-align: justify;
margin-top: 18px;
}
.protocol_box h1 {
font-size: 30px;
}
.protocol_box h2 {
font-size: 24px;
}
.protocol_box h3 {
font-size: 22px;
}
/*Outreach*/
.outreach_box{
background: none repeat scroll 0 0 #FFFFFF;
color: #000000;
display: block;
float: left;
font-size: 18px;
font-weight: 300;
line-height: 1.6;
margin-left: 10px;
margin-right: auto;
overflow: hidden;
padding: 10px;
width: 70%;
}
.outreach_box li {
margin-left:50px
}
/*Acknowlegement*/
.ack_box{
background: none repeat scroll 0 0 #FFFFFF;
color: #000000;
text-align: center;
display: block;
float: left;
font-size: 18px;
font-weight: 300;
line-height: 1.6;
margin-left: 10px;
margin-right: auto;
overflow: hidden;
padding: 10px;
width: 80%;
}
.ack_box p {
text-align: center;
}
.next, .prev{
z-index: 99;
background-image: url("http://openwetware.org/images/5/55/Fancybox_sprite.png");
width: 36px;
height: 36px;
top: 200px;
}
figure.box > .next {
left: 425px;
background-position: 0 -72px;
}
figure.box > .prev {
background-position: 0 -36px;
}
/**** Isotope styles ****/
/* required for containers to inherit vertical size from window */
html,
body {
height: 100%;
}
- container {
padding: 0px;
bottom-margin: 10px;
}
.box {
width: 220px;
height: 220px;
margin: 10px;
float: left;
overflow: hidden;
position: fixed;
background: #fff;
color: #000000;
display: table-cell;
text-align: center;
vertical-align: middle;
overflow:hidden;
}
div#b2x2{ position:fixed;}
figure.box > *{
left: 0;
position: absolute;
right: 0;
}
.box figure{
overflow: hidden;
}
.box figcaption {
background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4);
bottom: 0;
font-size: 20px;
font-weight: 300;
padding-left: 5px;
text-align: center;
width: 100%;
z-index: 4;
}
.clickable .box:hover {
cursor: pointer;
}
/* The Magnificent Clearfix: nicolasgallagher.com/micro-clearfix-hack/ */
.clearfix:before, .clearfix:after { content: ""; display: table; }
.clearfix:after { clear: both; }
.clearfix { zoom: 1; }
/* Start: Recommended Isotope styles */
/**** Isotope Filtering ****/
.isotope-item {
z-index: 2;
}
.isotope-hidden.isotope-item {
pointer-events: none;
z-index: 1;
}
/**** Isotope CSS3 transitions ****/
.isotope,
.isotope .isotope-item {
-webkit-transition-duration: 0.8s;
-moz-transition-duration: 0.8s;
-ms-transition-duration: 0.8s;
-o-transition-duration: 0.8s;
transition-duration: 0.8s;
}
.isotope {
-webkit-transition-property: height, width;
-moz-transition-property: height, width;
-ms-transition-property: height, width;
-o-transition-property: height, width;
transition-property: height, width;
}
.isotope .isotope-item {
-webkit-transition-property: -webkit-transform, opacity;
-moz-transition-property: -moz-transform, opacity;
-ms-transition-property: -ms-transform, opacity;
-o-transition-property: -o-transform, opacity;
transition-property: transform, opacity;
}
.rs-wrap:after,
.rs-slider:after,
.rs-thumb-wrap:after,
.rs-arrows:after,
.rs-caption:after {
content: ".";
display: block;
height: 0;
clear: both;
line-height: 0;
visibility: hidden;
}
/* ===[ Slider ]=== */
.rs-wrap {
position: relative;
max-width: 100%;
}
.rs-slide-bg { *zoom: 1 }
.rs-slider > li > a { display: block }
.rs-slider > li {
list-style: none;
filter: alpha(opacity=0);
opacity: 0;
width: 100%;
height: 100%;
margin: 0 -100% 0 0;
padding: 0;
float: left;
position: relative;
}
.rs-slider > li > a {
padding: 0;
background: none;
-webkit-border-radius: 0;
-moz-border-radius: 0;
border-radius: 0;
}
.rs-slider > li img {
display: block;
max-width: 100%;
max-height: 100%;
-ms-interpolation-mode: bicubic;
}
/* ===[ Thumbnails ]=== */
.rs-thumb-wrap { *zoom: 1 }
.rs-thumb-wrap > a {
display: block;
float: left;
position: relative;
-moz-box-sizing: border-box;
-webkit-box-sizing: border-box;
box-sizing: border-box;
-webkit-backface-visibility: hidden; /* Hardware accelerate to prevent jumps on transition */
}
.rs-thumb-wrap > a > img {
max-width: 100%;
max-height: 100%;
display: block;
-ms-interpolation-mode: bicubic;
}
.rs-thumb-wrap > a:first-child { margin-left: 0!important }
/* ===[ Arrows ]=== */
.rs-arrows .rs-next,
.rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");}
.rs-arrows .rs-next,
.rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");}
.rs-arrows:hover .rs-next,
.rs-arrows:hover .rs-prev { z-index: 2; }
/* ===[ Captions ]=== */
.rs-caption {
position: absolute;
max-height: 100%;
overflow: auto;
-moz-box-sizing: border-box;
-webkit-box-sizing: border-box;
box-sizing: border-box;
bottom: 0;
left: 0;
}
.rs-caption.rs-top-left {
top: 0;
bottom: auto;
}
.rs-caption.rs-top-right {
top: 0;
right: 0;
left: auto;
bottom: auto;
}
.rs-caption.rs-bottom-left {
bottom: 0;
left: 0;
}
.rs-caption.rs-bottom-right {
right: 0;
left: auto;
border-bottom: none;
border-right: none;
}
.rs-caption.rs-top {
top: 0;
bottom: auto;
width: 100%!important;
}
.rs-caption.rs-bottom { width: 100%!important }
.rs-caption.rs-left {
top: 0;
height: 100%;
}
.rs-caption.rs-right {
top: 0;
left: auto;
right: 0;
height: 100%;
}
/* ===[ Grid ]=== */
.rs-grid {
position: absolute;
overflow: hidden;
width: 100%;
height: 100%;
display: none;
}
.rs-gridlet {
position: absolute;
opacity: 1;
}
/* Optional - remove captions at smaller screen widths
@media screen and (max-width: 480px) {
.rs-caption { opacity: 0!important; }
}
- /
.project_box > img {
margin-left: 90px;
}
- protocols, #polymers_protocols, #origami_protocols, #reaction_protocols, #nanocontainer_protocols, #imaging_protocols {
font-size: 20px;
font-weight: 300;
margin-bottom: 30px;
margin-left: 50px;
}
- protocols > h2, #polymers_protocols > h2, #origami_protocols > h2, #reaction_protocols > h2, #nanocontainer_protocols > h2, #imaging_protocols > h2 {
margin-bottom: 20px;
margin-top: 20px;
}
- protocols .interlude, #polymers_protocols .interlude, #origami_protocols .interlude, #reaction_protocols .interlude, #nanocontainer_protocols .interlude, #imaging_protocols .interlude {
margin-left: -50px !important;
}
- protocols > ul {
margin-bottom: 30px;
margin-left: 30px;
margin-top: 20px;
}
li > ul {
margin-left: 10px;
}
/*achievement*/
.achievement_box{
background: none repeat scroll 0 0 #FFFFFF;
color: #000000;
display: block;
float: left;
font-size: 18px;
font-weight: 300;
line-height: 1.6;
margin-left: 180px;
margin-right: auto;
overflow: hidden;
padding: 10px;
width: 50%;
}
- subnav-sticky-wrapper {
height: 5px !important;
}
table {
border-collapse: collapse;
margin: auto auto 40px;
width: 635px;;
}
th {
background-color: #5F5F5F;
border: 1px solid #999999;
color: #FFFFFF;
}
tr td {
border: 1px solid #999999;
text-align: center;
}
tr.odd td {
background-color: #EEEEEE;
color: #000000;
}
.ref li {
font-size: 14px;
font-weight: 300;
}
</style>
<link href="http://openwetware.org/images/2/29/Nano_icon.png" rel="shortcut icon">
<script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.isotope.min.js"></script>
<script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.refineslide.min.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/jquery.fancybox.pack.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-buttons.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-media.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-thumbs.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.easing.min.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollUp.min.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.stellar.min.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.sticky.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollTo.min.js"></script>
<script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.localscroll.min.js"></script>
<script>
(function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){
(i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o),
m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m)
})(window,document,'script','//www.google-analytics.com/analytics.js','ga');
ga('create', 'UA-45176973-1', 'openwetware.org');
ga('send', 'pageview');
</script>
<style type="text/css">
/*! fancyBox v2.1.5 fancyapps.com | fancyapps.com/fancybox/#license */
.fancybox-wrap,
.fancybox-skin,
.fancybox-outer,
.fancybox-inner,
.fancybox-image,
.fancybox-wrap iframe,
.fancybox-wrap object,
.fancybox-nav,
.fancybox-nav span,
.fancybox-tmp
{
padding: 0;
margin: 0;
border: 0;
outline: none;
vertical-align: top;
}
.fancybox-wrap {
position: absolute;
top: 0;
left: 0;
z-index: 8020;
}
.fancybox-skin {
position: relative;
background: #f9f9f9;
color: #444;
text-shadow: none;
-webkit-border-radius: 4px;
-moz-border-radius: 4px;
border-radius: 4px;
}
.fancybox-opened {
z-index: 8030;
}
.fancybox-opened .fancybox-skin {
-webkit-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5);
-moz-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5);
box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5);
}
.fancybox-outer, .fancybox-inner {
position: relative;
}
.fancybox-inner {
overflow: hidden;
}
.fancybox-type-iframe .fancybox-inner {
-webkit-overflow-scrolling: touch;
}
.fancybox-error {
color: #444;
font: 14px/20px "Helvetica Neue",Helvetica,Arial,sans-serif;
margin: 0;
padding: 15px;
white-space: nowrap;
}
.fancybox-image, .fancybox-iframe {
display: block;
width: 100%;
height: 100%;
}
.fancybox-image {
max-width: 100%;
max-height: 100%;
}
- fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span {
background-image: url('http://openwetware.org/images/5/55/Fancybox_sprite.png');
}
- fancybox-loading {
position: fixed;
top: 50%;
left: 50%;
margin-top: -22px;
margin-left: -22px;
background-position: 0 -108px;
opacity: 0.8;
cursor: pointer;
z-index: 8060;
}
- fancybox-loading div {
width: 44px;
height: 44px;
background: url('http://openwetware.org/images/d/d0/Fancybox_loading.gif') center center no-repeat;
}
.fancybox-close {
position: absolute;
top: -18px;
right: -18px;
width: 36px;
height: 36px;
cursor: pointer;
z-index: 8040;
}
.fancybox-nav {
position: absolute;
top: 0;
width: 40%;
height: 100%;
cursor: pointer;
text-decoration: none;
background: transparent url('http://openwetware.org/images/c/c0/Blank.gif'); /* helps IE */
-webkit-tap-highlight-color: rgba(0,0,0,0);
z-index: 8040;
}
.fancybox-prev {
left: 0;
}
.fancybox-next {
right: 0;
}
.fancybox-nav span {
position: absolute;
top: 50%;
width: 36px;
height: 34px;
margin-top: -18px;
cursor: pointer;
z-index: 8040;
visibility: hidden;
}
.fancybox-prev span {
left: 10px;
background-position: 0 -36px;
}
.fancybox-next span {
right: 10px;
background-position: 0 -72px;
}
.fancybox-nav:hover span {
visibility: visible;
}
.fancybox-tmp {
position: absolute;
top: -99999px;
left: -99999px;
visibility: hidden;
max-width: 99999px;
max-height: 99999px;
overflow: visible !important;
}
/* Overlay helper */
.fancybox-lock {
overflow: hidden !important;
width: auto;
}
.fancybox-lock body {
overflow: hidden !important;
}
.fancybox-lock-test {
overflow-y: hidden !important;
}
.fancybox-overlay {
position: absolute;
top: 0;
left: 0;
overflow: hidden;
display: none;
z-index: 8010;
background: url('http://openwetware.org/images/e/e0/Fancybox_overlay.png');
}
.fancybox-overlay-fixed {
position: fixed;
bottom: 0;
right: 0;
}
.fancybox-lock .fancybox-overlay {
overflow: auto;
overflow-y: scroll;
}
/* Title helper */
.fancybox-title {
visibility: hidden;
font: normal 13px/20px "Helvetica Neue",Helvetica,Arial,sans-serif;
position: relative;
text-shadow: none;
z-index: 8050;
}
.fancybox-opened .fancybox-title {
visibility: visible;
}
.fancybox-title-float-wrap {
position: absolute;
bottom: 0;
right: 50%;
margin-bottom: -35px;
z-index: 8050;
text-align: center;
}
.fancybox-title-float-wrap .child {
display: inline-block;
margin-right: -100%;
padding: 2px 20px;
background: transparent; /* Fallback for web browsers that doesn't support RGBa */
background: rgba(0, 0, 0, 0.8);
-webkit-border-radius: 15px;
-moz-border-radius: 15px;
border-radius: 15px;
text-shadow: 0 1px 2px #222;
color: #FFF;
font-weight: bold;
line-height: 24px;
white-space: nowrap;
}
.fancybox-title-outside-wrap {
position: relative;
margin-top: 10px;
color: #fff;
}
.fancybox-title-inside-wrap {
padding-top: 10px;
}
.fancybox-title-over-wrap {
position: absolute;
bottom: 0;
left: 0;
color: #fff;
padding: 10px;
background: #000;
background: rgba(0, 0, 0, .8);
}
/*Retina graphics!*/
@media only screen and (-webkit-min-device-pixel-ratio: 1.5),
only screen and (min--moz-device-pixel-ratio: 1.5),
only screen and (min-device-pixel-ratio: 1.5){
#fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span {
background-image: url('http://openwetware.org/images/b/b8/Fancybox_sprite%402x.png');
background-size: 44px 152px; /*The size of the normal image, half the size of the hi-res image*/
}
#fancybox-loading div {
background-image: url('http://openwetware.org/images/0/01/Fancybox_loading%402x.gif');
background-size: 24px 24px; /*The size of the normal image, half the size of the hi-res image*/
}
}
- fancybox-buttons {
position: fixed;
left: 0;
width: 100%;
z-index: 8050;
}
- fancybox-buttons.top {
top: 10px;
}
- fancybox-buttons.bottom {
bottom: 10px;
}
- fancybox-buttons ul {
display: block;
width: 166px;
height: 30px;
margin: 0 auto;
padding: 0;
list-style: none;
border: 1px solid #111;
border-radius: 3px;
-webkit-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05);
-moz-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05);
box-shadow: inset 0 0 0 1px rgba(255,255,255,.05);
background: rgb(50,50,50);
background: -moz-linear-gradient(top, rgb(68,68,68) 0%, rgb(52,52,52) 50%, rgb(41,41,41) 50%, rgb(51,51,51) 100%);
background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgb(68,68,68)), color-stop(50%,rgb(52,52,52)), color-stop(50%,rgb(41,41,41)), color-stop(100%,rgb(51,51,51)));
background: -webkit-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%);
background: -o-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%);
background: -ms-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%);
background: linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%);
filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#444444', endColorstr='#222222',GradientType=0 );
}
- fancybox-buttons ul li {
float: left;
margin: 0;
padding: 0;
}
- fancybox-buttons a {
display: block;
width: 30px;
height: 30px;
text-indent: -9999px;
background-color: transparent;
background-image: url('fancybox_buttons.png');
background-repeat: no-repeat;
outline: none;
opacity: 0.8;
}
- fancybox-buttons a:hover {
opacity: 1;
}
- fancybox-buttons a.btnPrev {
background-position: 5px 0;
}
- fancybox-buttons a.btnNext {
background-position: -33px 0;
border-right: 1px solid #3e3e3e;
}
- fancybox-buttons a.btnPlay {
background-position: 0 -30px;
}
- fancybox-buttons a.btnPlayOn {
background-position: -30px -30px;
}
- fancybox-buttons a.btnToggle {
background-position: 3px -60px;
border-left: 1px solid #111;
border-right: 1px solid #3e3e3e;
width: 35px
}
- fancybox-buttons a.btnToggleOn {
background-position: -27px -60px;
}
- fancybox-buttons a.btnClose {
border-left: 1px solid #111;
width: 35px;
background-position: -56px 0px;
}
- fancybox-buttons a.btnDisabled {
opacity : 0.4;
cursor: default;
}
- fancybox-thumbs {
position: fixed;
left: 0;
width: 100%;
overflow: hidden;
z-index: 8050;
}
- fancybox-thumbs.bottom {
bottom: 2px;
}
- fancybox-thumbs.top {
top: 2px;
}
- fancybox-thumbs ul {
position: relative;
list-style: none;
margin: 0;
padding: 0;
}
- fancybox-thumbs ul li {
float: left;
padding: 1px;
opacity: 0.5;
}
- fancybox-thumbs ul li.active {
opacity: 0.75;
padding: 0;
border: 1px solid #fff;
}
- fancybox-thumbs ul li:hover {
opacity: 1;
}
- fancybox-thumbs ul li a {
display: block;
position: relative;
overflow: hidden;
border: 1px solid #222;
background: #111;
outline: none;
}
- fancybox-thumbs ul li img {
display: block;
position: relative;
border: 0;
padding: 0;
max-width: none;
}
p.serif {
font-family: "Times New Roman", Times, serif;
}
.box.b1x3{
width: 853px;
height: 465px;
}
- b2x2
{
position:fixed;
}
- main-nav {
width: 100%;
height: 67px;
background: #f2f2f2;
}
- main-nav .subnav {
display: none;
position: absolute;
top: 67px;
left: 0px;
right:0px;
width: 100%;
list-style-type: none;
background: #f2f2f2;
margin: 0;
border:solid 1px #eeeeee;
z-index:5;
padding:0;
}
- main-nav .subnav li {
display: block;
border-bottom: solid 1px #580000;
margin:0;
}
- main-nav .subnav li a {
color: #333;
height:18px;
font-size:20px;
}
- main-nav .subnav li a:hover {
background:#f9f9f9;
}
- nav-primary {
list-style-type: none;
margin: 0;
float: left;
padding:0;
}
- nav-primary li {
float: left;
position: relative;
}
- nav-primary li a {
float: left;
color: #000;
text-align: center;
font-size: 20px;
height: 40px;
padding-top: 35px;
line-height: 13px;
width:120px;
text-decoration:none;
}
- nav-primary li a:hover {
text-decoration:none;
color:#FFCC00;
}
- nav-primary li:hover .subnav {
display: block;
}
</style>
<nav id = "main-nav">
</nav>
<img src = "http://openwetware.org/images/1/1b/Rsz_ascube.png">
Tile Assembly
--buffer stock (10x TAE/Mg2+)
--ssDNA strand stocks (need to put in sequence)
BT1, CCGGTGGTAAGGTCCGTATGTTAACCGCAGGACCTACA
BT2, CTATGTGTGAATATCATATGTAGGTCCTGCGGTTGAGGTATGCGG
BT3, TATGATATTCACACATAGAACCGTGAGATTGGG
BT4, TGGGTCCGGACTCGGTGCGAGACTCCCAATCTCACGGTT
BT5, AGTCTCGCACCGAGTTATCGTACATACCACCCA
BT6, GCCATGGCGATCCGGACCCATTTTT
BT7, TGGAGAGTGATGCCTTACCACCGGCGCGTTCTCCGGGCAACGCCTCTGGGTGGTCCCGATCT
BT8A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGGAGAACGCG
BT9, CTGAAGACGCAGGGTGAGAGGATGTACGATAATCGCCATGGC
BT10,TTTGCCGGCCTTAGCCAAAACATCACTCTCCACGCCAGTCACGTCGTGGTGCCGAGATCGGGCCTCTCACCCTTGCTACCTTCT
BT11A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGTGACTGGCG
BT12, CCAGCAAACCGCGTCTTCAGTTTTT
BT13, AATGCGTGTCTGGCCGGCAAACTGTCGACCGCGACAGAATGT
BT14, GCTTAACTGATCCATCAGTTCACATTCTGTCGCGGTCGACAG
BT15, GAACTGATGGATCAGTTAAGCAGAAGGTAGCAGGTTTGCTGG
BT16A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNGAGGCGTTGCC
BT17A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGGCACCACGA
BT18, TTTTTCCGCATACCTCAGGTTAAGCGG
BT19, CCGCTTAACCTAACATACGGATTTTGGCTAACATATCGCTCC
BT20, TTTTTGGAGCGATATGAGACACGCATT
BT21C, GAGGCGTTGCCCGGAGAACGCG
BT22C, CGGCACCACGACGTGACTGGC
<script>
$(function(){
var $container = $('#container');
$container.isotope({
itemSelector : '.box',
columnWidth: 220,
sortBy : 'random',
gutterWidth: 8,
cornerStampSelector: '.logo',
category : function( $elem ) {
return $elem.attr('data-category');
},
sortBy: 'category'
});
});
</script>
<script>
$(function () {
$('.rs-slider').refineSlide({
transition : 'fade',
useThumbs : false,
autoplay: false,
maxWidth: 460,
onInit : function () {
var slider = this.slider;
$('.next').on('click', function (e) {
e.preventDefault();
slider.next()
});
$('.prev').on('click', function (e) {
e.preventDefault();
slider.prev()
});
}
});
});
</script>
<script>
$(document).ready(function() {
$(".yt").fancybox({
maxWidth : 800,
maxHeight : 600,
fitToView : false,
width : '70%',
height : '70%',
autoSize : false,
closeClick : false,
openEffect : 'none',
closeEffect : 'none'
});
});
</script>
Views
- <a href="/wiki/Biomod/2014/ASU" title="View the content page [c]" accesskey="c">Page</a>
- <a href="/index.php?title=Talk:Biomod/2014/ASU&action=edit" title="Discussion about the content page [t]" accesskey="t">Talk</a>
- <a href="/index.php?title=Biomod/2014/ASU&action=edit" title="This page is protected.
You can view its source. [e]" accesskey="e">View source</a>
- <a href="/index.php?title=Biomod/2014/ASU&action=history" title="Past versions of this page. [h]" accesskey="h">History</a>
Personal tools
- <a href="/wiki/User:209.147.144.5" title="The user page for the ip you're editing as [.]" accesskey="." class="new">209.147.144.5</a>
- <a href="/wiki/User_talk:209.147.144.5" title="Discussion about edits from this ip address [n]" accesskey="n" class="new">Talk for this IP</a>
- <a href="/index.php?title=Special:UserLogin&returnto=Biomod/2014/ASU" title="You are encouraged to log in, it is not mandatory however. [o]" accesskey="o">Log in</a>
<script type="text/javascript">if (window.runOnloadHook) runOnloadHook();</script>
<script src="/js/Urchin/urchin.js" type="text/javascript">
</script>
<script type="text/javascript">
_uacct = "UA-2860391-2";
urchinTracker();
</script>
</body></html>