Biomod/2014/ASU/Materials

From OpenWetWare
Revision as of 09:33, 23 October 2014 by Samuel Gowland (talk | contribs)
Jump to navigationJump to search

<html xmlns="http://www.w3.org/1999/xhtml" xmlns:v="urn:schemas-microsoft-com:vml" xml:lang="en" lang="en" dir="ltr"> <head>

<title>Nanodevils - OpenWetWare</title> <style type="text/css" media="screen, projection">/*<![CDATA[*/ @import "/skins/common/shared.css?164"; @import "/skins/monobook/main.css?164"; /*]]>*/</style> <link rel="stylesheet" type="text/css" media="print" href="/skins/common/commonPrint.css?164" />

<script type= "text/javascript">/*<![CDATA[*/ var skin = "monobook"; var stylepath = "/skins"; var wgArticlePath = "/wiki/$1"; var wgScriptPath = ""; var wgScript = "/index.php"; var wgVariantArticlePath = false; var wgActionPaths = []; var wgServer = "http://openwetware.org"; var wgCanonicalNamespace = ""; var wgCanonicalSpecialPageName = false; var wgNamespaceNumber = 0; var wgPageName = "Biomod/2014/ASU"; var wgTitle = "Biomod/2014/ASU"; var wgAction = "view"; var wgArticleId = "136275"; var wgIsArticle = true; var wgUserName = null; var wgUserGroups = null; var wgUserLanguage = "en"; var wgContentLanguage = "en"; var wgBreakFrames = false; var wgCurRevisionId = "750826"; var wgVersion = "1.13.2"; var wgEnableAPI = true; var wgEnableWriteAPI = false; var wgMWSuggestTemplate = "http://openwetware.org/api.php?action=opensearch\x26search={searchTerms}\x26namespace={namespaces}"; var wgDBname = "owwdb"; var wgSearchNamespaces = [0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 100, 101, 110, 111]; var wgMWSuggestMessages = ["with suggestions", "no suggestions"]; var wgRestrictionEdit = []; var wgRestrictionMove = []; /*]]>*/</script>

<script type="text/javascript" src="/skins/common/wikibits.js?164"></script> <script type="text/javascript" src="/skins/common/ajax.js?164"></script> <script type="text/javascript" src="/ext/AjaxShowEditors/AjaxShowEditors.js"></script> <script type="text/javascript" src="/skins/common/mwsuggest.js?164"></script> <script type="text/javascript" src="/index.php?title=-&action=raw&gen=js&useskin=monobook"></script> <style type="text/css">/*<![CDATA[*/ @import "/index.php?title=MediaWiki:Common.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000"; @import "/index.php?title=MediaWiki:Monobook.css&usemsgcache=yes&action=raw&ctype=text/css&smaxage=18000"; @import "/index.php?title=-&action=raw&gen=css&maxage=18000&useskin=monobook"; /*]]>*/</style> </head> <body class="mediawiki ns-0 ltr page-Biomod_2014_ASU">

<a name="top" id="top"></a>

Biomod/2014/ASU

From OpenWetWare

< <a href="/wiki/Biomod" title="Biomod">Biomod</a> | <a href="/wiki/Biomod/2014" title="Biomod/2014">2014</a>
Jump to: <a href="#column-one">navigation</a>, <a href="#searchInput">search</a>

<link rel="stylesheet" href="http://fonts.googleapis.com/css?family=Lato:300,100&subset=latin"> <script src="//ajax.googleapis.com/ajax/libs/jquery/1.10.2/jquery.min.js" ></script> <script type"text/javascript"> $(function () { $("style[media*='screen']").remove(); $("link[href*='favicon']").remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); $("tr:odd").addClass("odd"); }); </script> <style type="text/css"> /**** Base styles ****/

  1. column-one, #footer, div#sidebar-main, #contentSub, .firstHeading, #siteSub, #jump-to-nav, .printfooter{
display: none; }
  1. content {
margin: 0; padding: 0; background: #fff; border: none; } html, body, div, span, object, iframe, h1, h2, h3, h4, h5, h6, p, blockquote, pre, abbr, address, cite, code, del, dfn, em, img, ins, kbd, q, samp, small, strong, sub, sup, var, b, i, dl, dt, dd, ol, ul, li, fieldset, form, label, legend, table, caption, tbody, tfoot, thead, tr, th, td, article, aside, canvas, details, figcaption, figure, footer, header, hgroup, menu, nav, section, summary, time, mark, audio, video { margin: 0; padding: 0; border: 0; font: inherit; } article, aside, details, figcaption, figure, footer, header, hgroup, menu, nav, section { display: block; } body { /*padding: 15px;*/ font-family: 'Lato', 'Lucida Sans Regular', 'Lucida Grande', 'Lucida Sans Unicode', Arial, sans-serif; font-size: 2rem; font-weight: 200; line-height: 1.4; background: #fff; color: #000000; max-width: 1280px; padding-top: 55px; margin-left: auto; margin-right: auto; } } h1, h2, h3, p, ul, ol, pre, dl { font-weight: 100; } h1, h2, #super-list, .box, .tagline, #index-list { font-family: 'Lato', 'Helvetica Neue', Arial, sans-serif; } h1, h2, h3 { font-weight: 300; } h1 { font-size: 16px; line-height: 1.1em; } h2 { font-size: 22px; } a, a code { color: #FB4; text-decoration: none; } a:hover, a:hover code { color: #FFCC00; } a:active, a:active code { color: #000000; /*background: black;*/ } a img { border: none; } a.anchor{display: block; position: relative; visibility: hidden;} p{ text-align:left; } em { color: #00EF00; } strong { font-weight: bold; } blockquote { padding-left: 1.0em; margin-left: 1.0em; border-left: 1px solid #333; font-style: italic; } nav { background: rgba(25, 25, 25, 0.85); padding: 0px; position: fixed; top: 0px; left: 0px; bottom: 0px; right: 0px; z-index: 100; } nav ul { width: 100%; margin: 0px auto; padding: 0px; list-style-type: none; } nav ul li { float: left; line-height:2.5; } nav ul li.selected { border-bottom: solid 10px #580000; } nav ul li.home { padding: 0px; } nav ul a { float: left; text-decoration: none; color: #F2F2F2; text-transform: uppercase; font-size: 20px; font-weight: 300; padding: 0px 20px 0; }
  1. content {
margin-top: 60px; }
  1. filters > li{
margin: 0px; display: inline-block; } .box.clickable:hover{ background: none repeat scroll 0 0 #fff; } .clickable img { transition: 0.3s ease; } .clickable img:hover { opacity:0.9; transition: 0.3s ease; } .background { left: 0; margin: 0; max-width: 100%; padding: 0; } /*the boxes*/ .box.b2x2{ height: 300px; width: 300px; position: fixed; } .box.b2x2 > img{ display: block; margin-left: auto; margin-right: auto; margin-top: 10px; height: 300px; width: 300px; position: fixed; } .box.b2x1{ height: 360px; } .box.b1x2{ width: 930px; height: 1500px; } .box.b1x3{ width: 700px; } /*start page*/ .box.intro { font-size:7.2rem;} .box > p { font-size: 16px; padding: 0 20px; margin-top: 10px; text-align: justify; font-weight: 300; } .box > h2 { font-size: 20px; font-weight: 100; text-align:left; margin-left: 20px; margin-top: 15px; } .tease > h2 { font-size: 40px; font-weight: 100; margin-top: 80px; } /*project*/ .project{ background-attachment: fixed; width: 100%; padding-bottom: 40px; } .project h2 { color: #FFFFFF; font-weight: 300; margin-bottom: 30px; margin-left: 180px; padding-top: 20px; position: relative; } .project h3 { font-size: 26px; } .project .box { margin-bottom: 20px; margin-top: 0; } .interlude{ background: none repeat scroll 0 0 #2A2A2A; box-shadow: 0 0 25px rgba(0, 0, 0, 0.8); border: 1px solid rgba(0, 0, 0, 0.3); height: 150px; position: relative; z-index: 3; } .interlude *{ float:left; } .interlude h2{ color: #FFFFFF; display: block; font-weight: 300; line-height: 150px; margin-left: 24%; margin-right: -14%; width: 50%; } .interlude img{ float: left; line-height: 150px; margin-left: 10%; margin-top: 25px; vertical-align: middle; } .clear{ clear: both; } .project_box{ background: none repeat scroll 0 0 #FFFFFF; color: #000000; display: block; float: left; font-size: 18px; font-weight: 300; line-height: 1.6; margin-left: auto; margin-right: auto; overflow: hidden; padding: 10px; width: 50%; } .figure_box{ display: block; float: left; margin-left: 20px; overflow: hidden; width: 230px; } /*se*/ .project_box h2{ color: #1A1A1A; display: block; font-weight: 300; margin-left: 0%; margin-right: -10%; width: 90%; } .project_box p{ text-align: justify; margin-bottom: 18px; } .project_box li { margin-left:50px }
  1. pb_mot.project_box{
height: 350px; }
  1. pb_dna_scaff.project_box{
height: 400px; }
  1. pb_dna_req.project_box{
height: 250px; }
  1. pb_poly_intro.project_box{
/*right: -20%;*/ height: 200px; }
  1. pb_poly_pmoxa.project_box{
/*right: -20%;*/ height: 600px; width: 1000px; overflow:scroll; }
  1. pb_ir.project_box{
/*right: -20%;*/ height: 1300px; }
  1. pb_poly_cp.project_box{
/*right: -20%;*/ height: 600px; } /*team page*/ .bio_box { background: none repeat scroll 0 0 #E74C3C; float: left; font-size: 15px; height: 440px; padding: 15px; text-align: justify; width: 210px; } .bio_box > .name{ font-size: 24px; font-weight: 300; margin-bottom: 25px; text-align: center; width: 100%; } .bio_box > p{ text-align: justify; font-weight: 300; font-size: 16px; } .box.big img{ opacity:1; } .flag > *{ float:left; } .flag > p{ font-size: 18px; position: relative; text-align: center; top: -6px; width: 75%; margin-bottom: 10px; }
  1. team .big{
opacity:1; } .head{ width:220px; float:left; } /*sponsor page*/
  1. sponsors .box {
background: none repeat scroll 0 0 white; }
  1. sponsors figcaption {
height: 65px; width: 100%; font-size: 15px; font-weight: 300; top: auto; bottom: 0; opacity: 0; transform: translateY(100%); transition: transform 0.4s, opacity 0.1s 0.3s; -webkit-transform: translateY(100%); -webkit-transition: -webkit-transform 0.4s, opacity 0.1s 0.3s; }
  1. sponsors .descr{
background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4); font-size: 12px; font-weight: 300; height: 60px; margin: 0; padding-left: 10px; padding-right: 10px; padding-top: 10px; text-align: justify; top: -155px; line-height: 1.3; }
  1. sponsors .descr p{
width:90%; margin-left:auto; margin-right:auto; }
  1. sponsors figure.clickable:hover figcaption{
opacity: 1; transform: translateY(0px); transition: transform 0.4s, opacity 0.1s; -webkit-transform: translateY(0px); -webkit-transition: -webkit-transform 0.4s, opacity 0.1s; }
  1. sponsors figure:hover .descr{
opacity: 1; transform: translateY(155px); transition: transform 0.4s, opacity 0.1s; -webkit-transform: translateY(155px); -webkit-transition: -webkit-transform 0.4s, opacity 0.1s; } /*gallery*/
  1. gallery .box img{
min-height: 220px; min-width: 220px; } /*ptocols*/ .protocol_box{ background: none repeat scroll 0 0 #FFFFFF; color: #000000; display: block; float: left; font-size: 18px; font-weight: 300; line-height: 1.6; margin-left: 40px; margin-right: auto; overflow: hidden; padding: 10px; width: 66%; } .protocol_box li { margin-left:50px } .protocol_box p{ text-align: justify; margin-top: 18px; } .protocol_box h1 { font-size: 30px; } .protocol_box h2 { font-size: 24px; } .protocol_box h3 { font-size: 22px; } /*Outreach*/ .outreach_box{ background: none repeat scroll 0 0 #FFFFFF; color: #000000; display: block; float: left; font-size: 18px; font-weight: 300; line-height: 1.6; margin-left: 10px; margin-right: auto; overflow: hidden; padding: 10px; width: 70%; } .outreach_box li { margin-left:50px } /*Acknowlegement*/ .ack_box{ background: none repeat scroll 0 0 #FFFFFF; color: #000000; text-align: center; display: block; float: left; font-size: 18px; font-weight: 300; line-height: 1.6; margin-left: 10px; margin-right: auto; overflow: hidden; padding: 10px; width: 80%; } .ack_box p { text-align: center; } .next, .prev{ z-index: 99; background-image: url("http://openwetware.org/images/5/55/Fancybox_sprite.png"); width: 36px; height: 36px; top: 200px; } figure.box > .next { left: 425px; background-position: 0 -72px; } figure.box > .prev { background-position: 0 -36px; } /**** Isotope styles ****/ /* required for containers to inherit vertical size from window */ html, body { height: 100%; }
  1. container {
padding: 0px; bottom-margin: 10px; } .box { width: 220px; height: 220px; margin: 10px; float: left; overflow: hidden; position: fixed; background: #fff; color: #000000; display: table-cell; text-align: center; vertical-align: middle; overflow:hidden; } div#b2x2{ position:fixed;} figure.box > *{ left: 0; position: absolute; right: 0; } .box figure{ overflow: hidden; } .box figcaption { background: none repeat scroll 0 0 rgba(0, 0, 0, 0.4); bottom: 0; font-size: 20px; font-weight: 300; padding-left: 5px; text-align: center; width: 100%; z-index: 4; } .clickable .box:hover { cursor: pointer; } /* The Magnificent Clearfix: nicolasgallagher.com/micro-clearfix-hack/ */ .clearfix:before, .clearfix:after { content: ""; display: table; } .clearfix:after { clear: both; } .clearfix { zoom: 1; } /* Start: Recommended Isotope styles */ /**** Isotope Filtering ****/ .isotope-item { z-index: 2; } .isotope-hidden.isotope-item { pointer-events: none; z-index: 1; } /**** Isotope CSS3 transitions ****/ .isotope, .isotope .isotope-item { -webkit-transition-duration: 0.8s; -moz-transition-duration: 0.8s; -ms-transition-duration: 0.8s; -o-transition-duration: 0.8s; transition-duration: 0.8s; } .isotope { -webkit-transition-property: height, width; -moz-transition-property: height, width; -ms-transition-property: height, width; -o-transition-property: height, width; transition-property: height, width; } .isotope .isotope-item { -webkit-transition-property: -webkit-transform, opacity; -moz-transition-property: -moz-transform, opacity; -ms-transition-property: -ms-transform, opacity; -o-transition-property: -o-transform, opacity; transition-property: transform, opacity; } .rs-wrap:after, .rs-slider:after, .rs-thumb-wrap:after, .rs-arrows:after, .rs-caption:after { content: "."; display: block; height: 0; clear: both; line-height: 0; visibility: hidden; } /* ===[ Slider ]=== */ .rs-wrap { position: relative; max-width: 100%; } .rs-slide-bg { *zoom: 1 } .rs-slider > li > a { display: block } .rs-slider > li { list-style: none; filter: alpha(opacity=0); opacity: 0; width: 100%; height: 100%; margin: 0 -100% 0 0; padding: 0; float: left; position: relative; } .rs-slider > li > a { padding: 0; background: none; -webkit-border-radius: 0; -moz-border-radius: 0; border-radius: 0; } .rs-slider > li img { display: block; max-width: 100%; max-height: 100%; -ms-interpolation-mode: bicubic; } /* ===[ Thumbnails ]=== */ .rs-thumb-wrap { *zoom: 1 } .rs-thumb-wrap > a { display: block; float: left; position: relative; -moz-box-sizing: border-box; -webkit-box-sizing: border-box; box-sizing: border-box; -webkit-backface-visibility: hidden; /* Hardware accelerate to prevent jumps on transition */ } .rs-thumb-wrap > a > img { max-width: 100%; max-height: 100%; display: block; -ms-interpolation-mode: bicubic; } .rs-thumb-wrap > a:first-child { margin-left: 0!important } /* ===[ Arrows ]=== */ .rs-arrows .rs-next, .rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");} .rs-arrows .rs-next, .rs-arrows .rs-prev { z-index: 1; background-image: url("fancybox_sprite.png");} .rs-arrows:hover .rs-next, .rs-arrows:hover .rs-prev { z-index: 2; } /* ===[ Captions ]=== */ .rs-caption { position: absolute; max-height: 100%; overflow: auto; -moz-box-sizing: border-box; -webkit-box-sizing: border-box; box-sizing: border-box; bottom: 0; left: 0; } .rs-caption.rs-top-left { top: 0; bottom: auto; } .rs-caption.rs-top-right { top: 0; right: 0; left: auto; bottom: auto; } .rs-caption.rs-bottom-left { bottom: 0; left: 0; } .rs-caption.rs-bottom-right { right: 0; left: auto; border-bottom: none; border-right: none; } .rs-caption.rs-top { top: 0; bottom: auto; width: 100%!important; } .rs-caption.rs-bottom { width: 100%!important } .rs-caption.rs-left { top: 0; height: 100%; } .rs-caption.rs-right { top: 0; left: auto; right: 0; height: 100%; } /* ===[ Grid ]=== */ .rs-grid { position: absolute; overflow: hidden; width: 100%; height: 100%; display: none; } .rs-gridlet { position: absolute; opacity: 1; } /* Optional - remove captions at smaller screen widths @media screen and (max-width: 480px) { .rs-caption { opacity: 0!important; } }
  • /
.project_box > img { margin-left: 90px; }
  1. protocols, #polymers_protocols, #origami_protocols, #reaction_protocols, #nanocontainer_protocols, #imaging_protocols {
font-size: 20px; font-weight: 300; margin-bottom: 30px; margin-left: 50px; }
  1. protocols > h2, #polymers_protocols > h2, #origami_protocols > h2, #reaction_protocols > h2, #nanocontainer_protocols > h2, #imaging_protocols > h2 {
margin-bottom: 20px; margin-top: 20px; }
  1. protocols .interlude, #polymers_protocols .interlude, #origami_protocols .interlude, #reaction_protocols .interlude, #nanocontainer_protocols .interlude, #imaging_protocols .interlude {
margin-left: -50px !important; }
  1. protocols > ul {
margin-bottom: 30px; margin-left: 30px; margin-top: 20px; } li > ul { margin-left: 10px; } /*achievement*/ .achievement_box{ background: none repeat scroll 0 0 #FFFFFF; color: #000000; display: block; float: left; font-size: 18px; font-weight: 300; line-height: 1.6; margin-left: 180px; margin-right: auto; overflow: hidden; padding: 10px; width: 50%; }
  1. subnav-sticky-wrapper {
height: 5px !important; } table { border-collapse: collapse; margin: auto auto 40px; width: 635px;; } th { background-color: #5F5F5F; border: 1px solid #999999; color: #FFFFFF; } tr td { border: 1px solid #999999; text-align: center; } tr.odd td { background-color: #EEEEEE; color: #000000; } .ref li { font-size: 14px; font-weight: 300; } </style> <link href="http://openwetware.org/images/2/29/Nano_icon.png" rel="shortcut icon"> <script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.isotope.min.js"></script> <script src="https://biomod2013.googlecode.com/svn/trunk/js/jquery.refineslide.min.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/jquery.fancybox.pack.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-buttons.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-media.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/fb/helpers/jquery.fancybox-thumbs.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.easing.min.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollUp.min.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.stellar.min.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.sticky.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.scrollTo.min.js"></script> <script type="text/javascript" src="http://biomod2013.googlecode.com/svn/trunk/js/jquery.localscroll.min.js"></script> <script> (function(i,s,o,g,r,a,m){i['GoogleAnalyticsObject']=r;i[r]=i[r]||function(){ (i[r].q=i[r].q||[]).push(arguments)},i[r].l=1*new Date();a=s.createElement(o), m=s.getElementsByTagName(o)[0];a.async=1;a.src=g;m.parentNode.insertBefore(a,m) })(window,document,'script','//www.google-analytics.com/analytics.js','ga'); ga('create', 'UA-45176973-1', 'openwetware.org'); ga('send', 'pageview'); </script> <style type="text/css"> /*! fancyBox v2.1.5 fancyapps.com | fancyapps.com/fancybox/#license */ .fancybox-wrap, .fancybox-skin, .fancybox-outer, .fancybox-inner, .fancybox-image, .fancybox-wrap iframe, .fancybox-wrap object, .fancybox-nav, .fancybox-nav span, .fancybox-tmp { padding: 0; margin: 0; border: 0; outline: none; vertical-align: top; } .fancybox-wrap { position: absolute; top: 0; left: 0; z-index: 8020; } .fancybox-skin { position: relative; background: #f9f9f9; color: #444; text-shadow: none; -webkit-border-radius: 4px; -moz-border-radius: 4px; border-radius: 4px; } .fancybox-opened { z-index: 8030; } .fancybox-opened .fancybox-skin { -webkit-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); -moz-box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); box-shadow: 0 10px 25px rgba(0, 0, 0, 0.5); } .fancybox-outer, .fancybox-inner { position: relative; } .fancybox-inner { overflow: hidden; } .fancybox-type-iframe .fancybox-inner { -webkit-overflow-scrolling: touch; } .fancybox-error { color: #444; font: 14px/20px "Helvetica Neue",Helvetica,Arial,sans-serif; margin: 0; padding: 15px; white-space: nowrap; } .fancybox-image, .fancybox-iframe { display: block; width: 100%; height: 100%; } .fancybox-image { max-width: 100%; max-height: 100%; }
  1. fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span {
background-image: url('http://openwetware.org/images/5/55/Fancybox_sprite.png'); }
  1. fancybox-loading {
position: fixed; top: 50%; left: 50%; margin-top: -22px; margin-left: -22px; background-position: 0 -108px; opacity: 0.8; cursor: pointer; z-index: 8060; }
  1. fancybox-loading div {
width: 44px; height: 44px; background: url('http://openwetware.org/images/d/d0/Fancybox_loading.gif') center center no-repeat; } .fancybox-close { position: absolute; top: -18px; right: -18px; width: 36px; height: 36px; cursor: pointer; z-index: 8040; } .fancybox-nav { position: absolute; top: 0; width: 40%; height: 100%; cursor: pointer; text-decoration: none; background: transparent url('http://openwetware.org/images/c/c0/Blank.gif'); /* helps IE */ -webkit-tap-highlight-color: rgba(0,0,0,0); z-index: 8040; } .fancybox-prev { left: 0; } .fancybox-next { right: 0; } .fancybox-nav span { position: absolute; top: 50%; width: 36px; height: 34px; margin-top: -18px; cursor: pointer; z-index: 8040; visibility: hidden; } .fancybox-prev span { left: 10px; background-position: 0 -36px; } .fancybox-next span { right: 10px; background-position: 0 -72px; } .fancybox-nav:hover span { visibility: visible; } .fancybox-tmp { position: absolute; top: -99999px; left: -99999px; visibility: hidden; max-width: 99999px; max-height: 99999px; overflow: visible !important; } /* Overlay helper */ .fancybox-lock { overflow: hidden !important; width: auto; } .fancybox-lock body { overflow: hidden !important; } .fancybox-lock-test { overflow-y: hidden !important; } .fancybox-overlay { position: absolute; top: 0; left: 0; overflow: hidden; display: none; z-index: 8010; background: url('http://openwetware.org/images/e/e0/Fancybox_overlay.png'); } .fancybox-overlay-fixed { position: fixed; bottom: 0; right: 0; } .fancybox-lock .fancybox-overlay { overflow: auto; overflow-y: scroll; } /* Title helper */ .fancybox-title { visibility: hidden; font: normal 13px/20px "Helvetica Neue",Helvetica,Arial,sans-serif; position: relative; text-shadow: none; z-index: 8050; } .fancybox-opened .fancybox-title { visibility: visible; } .fancybox-title-float-wrap { position: absolute; bottom: 0; right: 50%; margin-bottom: -35px; z-index: 8050; text-align: center; } .fancybox-title-float-wrap .child { display: inline-block; margin-right: -100%; padding: 2px 20px; background: transparent; /* Fallback for web browsers that doesn't support RGBa */ background: rgba(0, 0, 0, 0.8); -webkit-border-radius: 15px; -moz-border-radius: 15px; border-radius: 15px; text-shadow: 0 1px 2px #222; color: #FFF; font-weight: bold; line-height: 24px; white-space: nowrap; } .fancybox-title-outside-wrap { position: relative; margin-top: 10px; color: #fff; } .fancybox-title-inside-wrap { padding-top: 10px; } .fancybox-title-over-wrap { position: absolute; bottom: 0; left: 0; color: #fff; padding: 10px; background: #000; background: rgba(0, 0, 0, .8); } /*Retina graphics!*/ @media only screen and (-webkit-min-device-pixel-ratio: 1.5), only screen and (min--moz-device-pixel-ratio: 1.5), only screen and (min-device-pixel-ratio: 1.5){ #fancybox-loading, .fancybox-close, .fancybox-prev span, .fancybox-next span { background-image: url('http://openwetware.org/images/b/b8/Fancybox_sprite%402x.png'); background-size: 44px 152px; /*The size of the normal image, half the size of the hi-res image*/ } #fancybox-loading div { background-image: url('http://openwetware.org/images/0/01/Fancybox_loading%402x.gif'); background-size: 24px 24px; /*The size of the normal image, half the size of the hi-res image*/ } }
  1. fancybox-buttons {
position: fixed; left: 0; width: 100%; z-index: 8050; }
  1. fancybox-buttons.top {
top: 10px; }
  1. fancybox-buttons.bottom {
bottom: 10px; }
  1. fancybox-buttons ul {
display: block; width: 166px; height: 30px; margin: 0 auto; padding: 0; list-style: none; border: 1px solid #111; border-radius: 3px; -webkit-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); -moz-box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); box-shadow: inset 0 0 0 1px rgba(255,255,255,.05); background: rgb(50,50,50); background: -moz-linear-gradient(top, rgb(68,68,68) 0%, rgb(52,52,52) 50%, rgb(41,41,41) 50%, rgb(51,51,51) 100%); background: -webkit-gradient(linear, left top, left bottom, color-stop(0%,rgb(68,68,68)), color-stop(50%,rgb(52,52,52)), color-stop(50%,rgb(41,41,41)), color-stop(100%,rgb(51,51,51))); background: -webkit-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: -o-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: -ms-linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); background: linear-gradient(top, rgb(68,68,68) 0%,rgb(52,52,52) 50%,rgb(41,41,41) 50%,rgb(51,51,51) 100%); filter: progid:DXImageTransform.Microsoft.gradient( startColorstr='#444444', endColorstr='#222222',GradientType=0 ); }
  1. fancybox-buttons ul li {
float: left; margin: 0; padding: 0; }
  1. fancybox-buttons a {
display: block; width: 30px; height: 30px; text-indent: -9999px; background-color: transparent; background-image: url('fancybox_buttons.png'); background-repeat: no-repeat; outline: none; opacity: 0.8; }
  1. fancybox-buttons a:hover {
opacity: 1; }
  1. fancybox-buttons a.btnPrev {
background-position: 5px 0; }
  1. fancybox-buttons a.btnNext {
background-position: -33px 0; border-right: 1px solid #3e3e3e; }
  1. fancybox-buttons a.btnPlay {
background-position: 0 -30px; }
  1. fancybox-buttons a.btnPlayOn {
background-position: -30px -30px; }
  1. fancybox-buttons a.btnToggle {
background-position: 3px -60px; border-left: 1px solid #111; border-right: 1px solid #3e3e3e; width: 35px }
  1. fancybox-buttons a.btnToggleOn {
background-position: -27px -60px; }
  1. fancybox-buttons a.btnClose {
border-left: 1px solid #111; width: 35px; background-position: -56px 0px; }
  1. fancybox-buttons a.btnDisabled {
opacity : 0.4; cursor: default; }
  1. fancybox-thumbs {
position: fixed; left: 0; width: 100%; overflow: hidden; z-index: 8050; }
  1. fancybox-thumbs.bottom {
bottom: 2px; }
  1. fancybox-thumbs.top {
top: 2px; }
  1. fancybox-thumbs ul {
position: relative; list-style: none; margin: 0; padding: 0; }
  1. fancybox-thumbs ul li {
float: left; padding: 1px; opacity: 0.5; }
  1. fancybox-thumbs ul li.active {
opacity: 0.75; padding: 0; border: 1px solid #fff; }
  1. fancybox-thumbs ul li:hover {
opacity: 1; }
  1. fancybox-thumbs ul li a {
display: block; position: relative; overflow: hidden; border: 1px solid #222; background: #111; outline: none; }
  1. fancybox-thumbs ul li img {
display: block; position: relative; border: 0; padding: 0; max-width: none; } p.serif { font-family: "Times New Roman", Times, serif; } .box.b1x3{ width: 853px; height: 465px; }
  1. b2x2
{ position:fixed; }
  1. main-nav {
width: 100%; height: 67px; background: #f2f2f2; }
  1. main-nav .subnav {
display: none; position: absolute; top: 67px; left: 0px; right:0px; width: 100%; list-style-type: none; background: #f2f2f2; margin: 0; border:solid 1px #eeeeee; z-index:5; padding:0; }
  1. main-nav .subnav li {
display: block; border-bottom: solid 1px #580000; margin:0; }
  1. main-nav .subnav li a {
color: #333; height:18px; font-size:20px; }
  1. main-nav .subnav li a:hover {
background:#f9f9f9; }
  1. nav-primary {
list-style-type: none; margin: 0; float: left; padding:0; }
  1. nav-primary li {
float: left; position: relative; }
  1. nav-primary li a {
float: left; color: #000; text-align: center; font-size: 20px; height: 40px; padding-top: 35px; line-height: 13px; width:120px; text-decoration:none; }
  1. nav-primary li a:hover {
text-decoration:none; color:#FFCC00; }
  1. nav-primary li:hover .subnav {
display: block; } </style>

<nav id = "main-nav">

</nav>

Tile Assembly


--buffer stock (10x TAE/Mg2+)

--ssDNA strand stocks (need to put in sequence)

          BT1, CCGGTGGTAAGGTCCGTATGTTAACCGCAGGACCTACA

          BT2, CTATGTGTGAATATCATATGTAGGTCCTGCGGTTGAGGTATGCGG

          BT3, TATGATATTCACACATAGAACCGTGAGATTGGG

          BT4, TGGGTCCGGACTCGGTGCGAGACTCCCAATCTCACGGTT

          BT5, AGTCTCGCACCGAGTTATCGTACATACCACCCA

          BT6, GCCATGGCGATCCGGACCCATTTTT

          BT7, TGGAGAGTGATGCCTTACCACCGGCGCGTTCTCCGGGCAACGCCTCTGGGTGGTCCCGATCT

          BT8A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGGAGAACGCG

          BT9, CTGAAGACGCAGGGTGAGAGGATGTACGATAATCGCCATGGC

          BT10,TTTGCCGGCCTTAGCCAAAACATCACTCTCCACGCCAGTCACGTCGTGGTGCCGAGATCGGGCCTCTCACCCTTGCTACCTTCT

          BT11A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGTGACTGGCG

          BT12, CCAGCAAACCGCGTCTTCAGTTTTT

          BT13, AATGCGTGTCTGGCCGGCAAACTGTCGACCGCGACAGAATGT

          BT14, GCTTAACTGATCCATCAGTTCACATTCTGTCGCGGTCGACAG

          BT15, GAACTGATGGATCAGTTAAGCAGAAGGTAGCAGGTTTGCTGG

          BT16A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNGAGGCGTTGCC

          BT17A, GATTGACCACACTGTNNNNNNNNNNNNNNNNNNNNCGGCACCACGA

          BT18, TTTTTCCGCATACCTCAGGTTAAGCGG

          BT19, CCGCTTAACCTAACATACGGATTTTGGCTAACATATCGCTCC

          BT20, TTTTTGGAGCGATATGAGACACGCATT

          BT21C, GAGGCGTTGCCCGGAGAACGCG

          BT22C, CGGCACCACGACGTGACTGGC


 <script>
   $(function(){
     var $container = $('#container');
     $container.isotope({
       itemSelector : '.box',
               columnWidth: 220,
               sortBy : 'random',
               gutterWidth: 8,
               cornerStampSelector: '.logo',
               category : function( $elem ) {
                               return $elem.attr('data-category');
                       },
               sortBy: 'category'
     });



   });
 </script>

<script>

$(function () { $('.rs-slider').refineSlide({ transition  : 'fade', useThumbs  : false, autoplay: false, maxWidth: 460, onInit : function () { var slider = this.slider; $('.next').on('click', function (e) { e.preventDefault(); slider.next() }); $('.prev').on('click', function (e) { e.preventDefault(); slider.prev() });

} }); }); </script> <script> $(document).ready(function() { $(".yt").fancybox({ maxWidth : 800, maxHeight : 600, fitToView : false, width : '70%', height : '70%', autoSize : false, closeClick : false, openEffect : 'none', closeEffect : 'none' }); }); </script>

 


Views
  • <a href="/wiki/Biomod/2014/ASU" title="View the content page [c]" accesskey="c">Page</a>
  • <a href="/index.php?title=Talk:Biomod/2014/ASU&action=edit" title="Discussion about the content page [t]" accesskey="t">Talk</a>
  • <a href="/index.php?title=Biomod/2014/ASU&action=edit" title="This page is protected. You can view its source. [e]" accesskey="e">View source</a>
  • <a href="/index.php?title=Biomod/2014/ASU&action=history" title="Past versions of this page. [h]" accesskey="h">History</a>
Personal tools
  • <a href="/wiki/User:209.147.144.5" title="The user page for the ip you're editing as [.]" accesskey="." class="new">209.147.144.5</a>
  • <a href="/wiki/User_talk:209.147.144.5" title="Discussion about edits from this ip address [n]" accesskey="n" class="new">Talk for this IP</a>
  • <a href="/index.php?title=Special:UserLogin&returnto=Biomod/2014/ASU" title="You are encouraged to log in, it is not mandatory however. [o]" accesskey="o">Log in</a>



<script type="text/javascript">if (window.runOnloadHook) runOnloadHook();</script>

<script src="/js/Urchin/urchin.js" type="text/javascript"> </script> <script type="text/javascript"> _uacct = "UA-2860391-2"; urchinTracker(); </script>

</body></html>