User:Faith Bruton/Notebook/Biology 210 at AU: Difference between revisions
Faith Bruton (talk | contribs) |
Faith Bruton (talk | contribs) |
||
| (10 intermediate revisions by the same user not shown) | |||
| Line 5: | Line 5: | ||
== 4/19/15--ZebraFish == | |||
'''Purpose: ''' The purpose of this lab was to examine the effects of nicotine on zebra fish larva. We were especially looking at survivability. | |||
'''Materials and Methods:''' Two petri dishes were gathered and labeled. One petri dish was filled with 20mL of Deer Park water. The other petri dish was filled with 20 mL of deer part water infused with nicotine. Twenty embryos were selected and placed into each petri dish. The petri dishes were set aside for safe keeping and observing. On the fifth day a drop of food was placed in the water to ensure life. On day 7 the water of each petri dish was replaced. The zebra fish were observed every two-three days. | |||
'''Data and Observations''' | |||
Day 1: It appeared that all of the zebra fish had died due to fungus. New petri dishes were set up and twenty new zebra fish were selected for each petri dish. The Zebra fish were primarily still in the "20-somites" stage as described in the lab book. | |||
Day 3: Nineteen Zebrafish were found alive in the control. Seventeen Zebrafish were found alive in the experimental. Most of the Zebra fish were still in the 20-somites stage. In the experimental 12 were in this stage and 5 were in the 25-somite stage. In the control 16 were in the 20-somite stage and 3 were in the 25-somites stage. | |||
Day 5: Seven Zebrafish were found alive in the experimental. They were all in the 25-somite stage and the beginning the 24 hour stage. Eleven Zebrafish were found alive in the control, they all appeared to be entering the 24 hour stage. | |||
Day 7: Four Zebrafish were alive in the nicotine petri dish. Seven were alive in the control petri dish. A movement assay was preformed. The Zebrafish in the nicotine petri dish preformed at a level 4 on a scale of 1-10. The Zebrafish in the control dish preformed at a level 7. Two control and one experimental Zebrafish were chosen to preserve. The control appeared more developed and moved more often. | |||
Day 9: One Zebrafish was found alive in the experimental. Five were still alive in the control. The zebrafish in the experimental appeared to be moving less than there were two days before. The zebrafish still alive were in the 24 hour and 28 hour stage. | |||
Day 14: All of the zebra fish living with the nicotine petri dish had died. There were three still alive in the other petri dish. | |||
'''Conclusion''' The nicotine affected the survivability of the Zebrafish. Zebrafish living within the nicotine began to drop off sooner than the control. Also it was primarily ones that were in later stages that seemed to be able to survive in the nicotine. Once the Zebrafish got to the 24 hour stage the ones living in the control seemed to move more often and more abruptly. One of the zebrafish living within the experimental found on day 7 would only move if prompted by something in the water. Overall the nicotine seemed to affect survivability, development, and movement. | |||
== 3/5/15--Bacterria == | == 3/5/15--Bacterria == | ||
'''Purpose:'''The purpose of this lab was to use a genetic sequence to specify what bacteria was found within Transect Three. | '''Purpose:'''The purpose of this lab was to use a genetic sequence to specify what bacteria was found within Transect Three. | ||
'''Materials and Methods:''' | '''Materials and Methods:''' PCR was used to amplify the 16S rRNA gene which was then sent out to be sequenced. The sequence was then plugged into BLAST to figure out what kind of bacteria it came from. BLAST used the sequence as a code to identify the kind of bacteria that has that specific 16s rRNA sequence. | ||
'''Data and Observation:''' The two sequences are listed below. The results of the BLAST was that Sample A was a Chryseobacteria and Sample D was a Varivox. | |||
Sample A: MB65 | |||
NNNNNNNNNNNNNNNNNCNNNNNNTGCNGNNNNANGGNNGNCNGNNNNNNANCAATCCTGGCGGCGAGTGGCGAACGGGT | |||
GAGTAATACATCGGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATG | |||
AAAGCAGGGGATCGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAA | |||
GCCTTCGATCTGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAG | |||
CAGTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACT | |||
GCTTTTGTACGGAACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTAC | |||
GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGT | |||
AAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGG | |||
AATTCCGCGTGTAGCANTGNAATGCGTAGATATGCGGAGGAACACCGATGGCGAANGCAATCCCCTGGACCTGTACTGAC | |||
GCTCATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTT | |||
GGGTCTTCACTGACTCANTAACGAAGCTNACNCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAANGTTGAAACTCNAA | |||
NGAATTGACNNGGACCCGCACAAGCNGTGNATGATGTGNTTTAATTCNATGCAACGCGAAAACCTTACCCACCTTTGACA | |||
TGTACNNNANTTNNNCCAGANATGGCTTANTGCTCGAAANAAAANCGTAACNCANGTGCTNCATGNCTNNCGTCNNCNTC | |||
NTGTCGTGANA | |||
Sample D: MB66 | |||
NNNNNNNNNNNNNNNNNANANTGNANNCCNNAGCGGTAGCAGANGNTATCANGATGTCCGACAGCGGCTTGCNGATGAGG | |||
TACAAGTGTGGTTTATGCCTTTAGCCGGGGGAGGCACTTTCGTTGGGAAGATTACAACCCCATAATTATAATCGTGGCAT | |||
CTCTTGAAANGGACTGGTCCAGTGGAAAAAGAAGGGCCCGACCCTGATGANGCAGTTGGTACGGGGACGGTTCACCANGG | |||
CTGTGATGTTTGTGGGGCCTGANAGGGTGATCCCCCTGTGTGGTACGGAGACATTGACCCAACACCAATTGCAGGCGCCT | |||
CTGAGGAATATTGGACAATGGGTGAGAGCCTGATCNNNANTCNNCGNGAAGGATGACGGTGCTCCTGGTTGTATTCTTCT | |||
TTTGTATATTGATGGTGATTTCCTCGTGGGTGAAGCTGAATGAACTATACAAGCAGNAACCGGNGAGGCCCNTGCCTTCA | |||
GCCTCGGTNNTACNCAGGGTGTTGCCGTTTGAGAGATTTATTGNNTTNTCGAGGTTGGTTCNNGCNGANGGCNNACAATA | |||
TGCTGTANNNNTNACTNNNNGGTCAATCTGCATANGTTGGCGCGNGNCGCGACTNTTGGATATCTACCTTGCNTAAAANA | |||
NTCNNACANGGAANNCNTANATAATANCNNNNNCACCAATTGCGAANGCAGGTTACTATGTCTTAACTGACGCTGATGGA | |||
CGAAAGCGTGGGGAGCGAACAGGATTANATACCCTGGTANTCCACGCCNTNNNNNATGCTNACTCGTTTTTGGGNTCTTC | |||
NGATTCAGAGACTAAACNAAAGTGATAAGTTAGCCACCTGGGGAGTACGTTCNCAAGANTGAAACTCNAAGGAATTGACN | |||
GNNCCCGCACAANCGGNGGATTATGTGNNTTNATTCNATGATACGCNANGAANCCTTNNCCNANGCTTAANTGGGNANTN | |||
GATCGGTTTNNNANNNNACCTTNCCTTNNNCAATTTCAAGGTNCTGCATGGNTNGTCNNCNGCTNNNNCCNNNANTNNNA | |||
GNTAANTCCTGNNNNNNNGNNNCCCCNTGTCNCNNN | |||
'''Conclusion:''' | '''Conclusion:''' Sample was classified as a Variovorax. Variovorax is a Gram negative rod shaped bacteria. We recorded Sample A however as a Gram positive bacteria. This could have been because something was amiss with the Gram stain, or we just read the results wrong. Sample D was a Chryseobacteria. These bacteria often appear in bright orange or yellow colonies, are Gram negative, and baccli. This matches with what we recorded in the first bacteria lab. | ||
Both of these bacteria are similar in that they are Gram negative and they are bacillus shaped. They both also reside in soil. Chryseobacteria can be found in soil, plants, and water, including tap water. Chryseobacteria indologenes can be a human pathogen, but primarily affects immunodeficient adults. Chryseobacteria is also interesting because it has been found to survive extreme cold environments (U.S. Micro-Solutions, 2011). The genus Variovorax is typical found in soil and plays a role in the sulfur breakdown and supply in the soil (Gahan & Schmalenberger, 2014) | |||
'''Sources:''' | |||
U.S. Micro-Solutions, Inc. Bacterial Library. (2011). Retrieved March 5, 2015, from http://www.usmicro-solutions.com/referencelibrary/bacteriallibrary.html | |||
Gahan, J., & Schmalenberger, A. (2014, December 14). The role of bacteria and mycorrhiza in plant sulfur supply. Retrieved March 5, 2015, from http://journal.frontiersin.org/article/10.3389/fpls.2014.00723/full | |||
FB | FB | ||
Latest revision as of 17:57, 19 March 2015
4/19/15--ZebraFish
Purpose: The purpose of this lab was to examine the effects of nicotine on zebra fish larva. We were especially looking at survivability.
Materials and Methods: Two petri dishes were gathered and labeled. One petri dish was filled with 20mL of Deer Park water. The other petri dish was filled with 20 mL of deer part water infused with nicotine. Twenty embryos were selected and placed into each petri dish. The petri dishes were set aside for safe keeping and observing. On the fifth day a drop of food was placed in the water to ensure life. On day 7 the water of each petri dish was replaced. The zebra fish were observed every two-three days.
Data and Observations
Day 1: It appeared that all of the zebra fish had died due to fungus. New petri dishes were set up and twenty new zebra fish were selected for each petri dish. The Zebra fish were primarily still in the "20-somites" stage as described in the lab book.
Day 3: Nineteen Zebrafish were found alive in the control. Seventeen Zebrafish were found alive in the experimental. Most of the Zebra fish were still in the 20-somites stage. In the experimental 12 were in this stage and 5 were in the 25-somite stage. In the control 16 were in the 20-somite stage and 3 were in the 25-somites stage.
Day 5: Seven Zebrafish were found alive in the experimental. They were all in the 25-somite stage and the beginning the 24 hour stage. Eleven Zebrafish were found alive in the control, they all appeared to be entering the 24 hour stage.
Day 7: Four Zebrafish were alive in the nicotine petri dish. Seven were alive in the control petri dish. A movement assay was preformed. The Zebrafish in the nicotine petri dish preformed at a level 4 on a scale of 1-10. The Zebrafish in the control dish preformed at a level 7. Two control and one experimental Zebrafish were chosen to preserve. The control appeared more developed and moved more often.
Day 9: One Zebrafish was found alive in the experimental. Five were still alive in the control. The zebrafish in the experimental appeared to be moving less than there were two days before. The zebrafish still alive were in the 24 hour and 28 hour stage.
Day 14: All of the zebra fish living with the nicotine petri dish had died. There were three still alive in the other petri dish.
Conclusion The nicotine affected the survivability of the Zebrafish. Zebrafish living within the nicotine began to drop off sooner than the control. Also it was primarily ones that were in later stages that seemed to be able to survive in the nicotine. Once the Zebrafish got to the 24 hour stage the ones living in the control seemed to move more often and more abruptly. One of the zebrafish living within the experimental found on day 7 would only move if prompted by something in the water. Overall the nicotine seemed to affect survivability, development, and movement.
3/5/15--Bacterria
Purpose:The purpose of this lab was to use a genetic sequence to specify what bacteria was found within Transect Three.
Materials and Methods: PCR was used to amplify the 16S rRNA gene which was then sent out to be sequenced. The sequence was then plugged into BLAST to figure out what kind of bacteria it came from. BLAST used the sequence as a code to identify the kind of bacteria that has that specific 16s rRNA sequence.
Data and Observation: The two sequences are listed below. The results of the BLAST was that Sample A was a Chryseobacteria and Sample D was a Varivox.
Sample A: MB65 NNNNNNNNNNNNNNNNNCNNNNNNTGCNGNNNNANGGNNGNCNGNNNNNNANCAATCCTGGCGGCGAGTGGCGAACGGGT GAGTAATACATCGGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATG AAAGCAGGGGATCGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAA GCCTTCGATCTGTAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGCAG CAGTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACT GCTTTTGTACGGAACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTAC GTGCCAGCAGCCGCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGT AAGACAGTTGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGG AATTCCGCGTGTAGCANTGNAATGCGTAGATATGCGGAGGAACACCGATGGCGAANGCAATCCCCTGGACCTGTACTGAC GCTCATGCACGAAAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTT GGGTCTTCACTGACTCANTAACGAAGCTNACNCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAANGTTGAAACTCNAA NGAATTGACNNGGACCCGCACAAGCNGTGNATGATGTGNTTTAATTCNATGCAACGCGAAAACCTTACCCACCTTTGACA TGTACNNNANTTNNNCCAGANATGGCTTANTGCTCGAAANAAAANCGTAACNCANGTGCTNCATGNCTNNCGTCNNCNTC NTGTCGTGANA
Sample D: MB66 NNNNNNNNNNNNNNNNNANANTGNANNCCNNAGCGGTAGCAGANGNTATCANGATGTCCGACAGCGGCTTGCNGATGAGG TACAAGTGTGGTTTATGCCTTTAGCCGGGGGAGGCACTTTCGTTGGGAAGATTACAACCCCATAATTATAATCGTGGCAT CTCTTGAAANGGACTGGTCCAGTGGAAAAAGAAGGGCCCGACCCTGATGANGCAGTTGGTACGGGGACGGTTCACCANGG CTGTGATGTTTGTGGGGCCTGANAGGGTGATCCCCCTGTGTGGTACGGAGACATTGACCCAACACCAATTGCAGGCGCCT CTGAGGAATATTGGACAATGGGTGAGAGCCTGATCNNNANTCNNCGNGAAGGATGACGGTGCTCCTGGTTGTATTCTTCT TTTGTATATTGATGGTGATTTCCTCGTGGGTGAAGCTGAATGAACTATACAAGCAGNAACCGGNGAGGCCCNTGCCTTCA GCCTCGGTNNTACNCAGGGTGTTGCCGTTTGAGAGATTTATTGNNTTNTCGAGGTTGGTTCNNGCNGANGGCNNACAATA TGCTGTANNNNTNACTNNNNGGTCAATCTGCATANGTTGGCGCGNGNCGCGACTNTTGGATATCTACCTTGCNTAAAANA NTCNNACANGGAANNCNTANATAATANCNNNNNCACCAATTGCGAANGCAGGTTACTATGTCTTAACTGACGCTGATGGA CGAAAGCGTGGGGAGCGAACAGGATTANATACCCTGGTANTCCACGCCNTNNNNNATGCTNACTCGTTTTTGGGNTCTTC NGATTCAGAGACTAAACNAAAGTGATAAGTTAGCCACCTGGGGAGTACGTTCNCAAGANTGAAACTCNAAGGAATTGACN GNNCCCGCACAANCGGNGGATTATGTGNNTTNATTCNATGATACGCNANGAANCCTTNNCCNANGCTTAANTGGGNANTN GATCGGTTTNNNANNNNACCTTNCCTTNNNCAATTTCAAGGTNCTGCATGGNTNGTCNNCNGCTNNNNCCNNNANTNNNA GNTAANTCCTGNNNNNNNGNNNCCCCNTGTCNCNNN
Conclusion: Sample was classified as a Variovorax. Variovorax is a Gram negative rod shaped bacteria. We recorded Sample A however as a Gram positive bacteria. This could have been because something was amiss with the Gram stain, or we just read the results wrong. Sample D was a Chryseobacteria. These bacteria often appear in bright orange or yellow colonies, are Gram negative, and baccli. This matches with what we recorded in the first bacteria lab. Both of these bacteria are similar in that they are Gram negative and they are bacillus shaped. They both also reside in soil. Chryseobacteria can be found in soil, plants, and water, including tap water. Chryseobacteria indologenes can be a human pathogen, but primarily affects immunodeficient adults. Chryseobacteria is also interesting because it has been found to survive extreme cold environments (U.S. Micro-Solutions, 2011). The genus Variovorax is typical found in soil and plays a role in the sulfur breakdown and supply in the soil (Gahan & Schmalenberger, 2014)
Sources: U.S. Micro-Solutions, Inc. Bacterial Library. (2011). Retrieved March 5, 2015, from http://www.usmicro-solutions.com/referencelibrary/bacteriallibrary.html Gahan, J., & Schmalenberger, A. (2014, December 14). The role of bacteria and mycorrhiza in plant sulfur supply. Retrieved March 5, 2015, from http://journal.frontiersin.org/article/10.3389/fpls.2014.00723/full FB
2/19/15--Vertebrates
Purpose: The purpose of this lab is to examine vertebrates, specifically those in Transect Three, to better understand the diversity of life.
Materials and Methods: A textbook was used to identify the kinds of vertebrates. A dictionary was used to define certain ecological concepts.
Data and Observations: Below are the classification of each vertebrate and a food web of the animals in the transect. https://docs.google.com/a/student.american.edu/document/d/1QF4xmXcn_IjpFa26__IzOf1r8HhRv-OVnl9RQ9YwPb0/edit?usp=sharing
Conclusion: Within the transect there are many biotic and abiotic factors found that might benefit a species. Most of the vertebrates wold be brought into the transect in search of food or a place to nest. The trees could act as a nesting place for the robin and sparrow. The bark on the trees as well as the seeds and a variety of insects could also be a food source for the birds. Squirrels and chipmunks would benefit from the transect because there are trees to nest in or because there might be more food sources for them in the warmer months. Rats would benefit from the piles of leaves because it provides a place to nest and hide. Rats also benefit from the trash and tree buds as a food source.
The vertebrates found within the transect play an important role in the ecology of the area. Community in ecology, refers to a population of one or more species living within the same space. In this way all the vertebrates found in the transect make up a community. Carrying capacity is the maximum number a population can have in a certain place considering the environment. Considering carrying capacity we could suppose that based on the size and resources available only a certain amount of birds and mammals could live in Transect Three. I would not be likely to see over fifty or even twenty vertebrates within the transect, but instead to see a few. Trophic levels refers to the position a living organism has on the food chain. Most of the vertebrates found in Transect Three do not hold a very high position but instead are primary or secondary consumers. This means that most of the animals in Transect Three either eats photosynthesizers or eats the things that eat photosynthesizers.
FB
2/19/15--Invertebrates
Purpose: The purpose of this lab was to examine the invertebrates living within Transect Three to better understand the diversity of life.
Materials and Methods: Last week a Bernese funnel was prepared with leaf litter from Transect Three. The funnel was taken apart and the ethanol solution was poured into two petri dishes. The petri dishes were then examined under a dissecting microscope. The invertebrates were then taken up by a micro-pipette and put onto a slide to be measured under a microscope.
Data and Observations: The Planaria seemed to glide. It would contract and then release moving its body forward. The the nematodes seemed to wiggle. Both of the ends moved at the same time. The Annelidasquirmed. Its whole body moved.
Below are observations from the Invertebrates. https://docs.google.com/a/student.american.edu/document/d/1QF4xmXcn_IjpFa26__IzOf1r8HhRv-OVnl9RQ9YwPb0/edit?usp=sharing
Conclusion: I think that the movement of the worms is reflected in their simple body structures because they all seem to contract and then release to move forward. The Planria was flat which played a role in how it glided backwards and forwards while the nematodes and Annelida were round and its whole body squirmed from left to right.
All of the invertebrates found within Transect Three appeared to be quite small. The smallest was the soil mite and the largest was the Proturan X. Overall we did not find many invertebrates in the ethanol solution, which could have been because we took the leaf litter from just the top layer of leaves instead of taking leaves and a some of the top soil. However, what was found suggests diversity in Transect Three.
FB
2/12/15--Plantae and Fungi
Purpose: The purpose of this lab is to examine the plant life and fungi living within out transect. This process will help us to better understand the diversity of life within our transect.
Materials and Methods: A plastic bag was used to collect a leaf litter or the top layer of leaves, sticks and dirt sitting within Transect Three. Another plastic bag was used to collect five samples of different plants from within our transect. Notes about the sample were taken. Back inside the lab a Berlese funnel was created to collect invertebrates. Twenty-five mL of 50:50 ethanol/water solution was poured into a 50mL conical tube. A screen was taped to the bottom of the funnel. Parafilm was placed around the funnel and tube so that the ethanol would not evaporate. The parafilm was covered with tape. The funnel and the tube were then attached to a stand sitting underneath a light fixture.
Data and Observations: Transect Three's leaf litter was was a collection of dead leaves. There were primarily medium sized leaves and smaller leaves within the leaf litter. The leaf litter was taken from the under the trees and bushes. Attachment was noted and many of the dead leaves reflected that of the few living ones on the larger trees and bushes from within the transect. The plant life found within Transect Three was all somewhat similar because it all appeared to have branches and leaves. The plants found were varied in terms of size and location, however all somewhat similar kinds of plants. Table 1: Plant Life as found on the google doc listed below lists some of the factors of each plant. The fungi sporangia are special cells that contain spores. The spores are released when the sporangia open. In this way reproduction is possible for the plant. None of the samples from within Transect Three appeared to be molds. Likewise, no mold could be found on the petri dishes from last week. Two types of fungi are drawn in the google doc. These fungi are obviously fungi because they exhibit features of fungi. The first fungi is Black Bread mold. It is has hyphae and sporangia and is in the division Zygomycota. The second fungi was a mushroom called cremini or Agaricus bisporus.This mushroom is part of the Basidiomucota group.
Conclusion: It appears that the majority of the plants living within Transect Three seem to be similar. They are all leafy trees or bushes. This could be because it is winter and the other plants are completely dead. Another explanation for this would be it is a manicured spot on campus and those are the only plants planted there.
2/5/15-- Identifying Bacteria
Purpose: The purpose of this lab is to examine the kinds of bacteria found within Transect 3 and prepare PCR reactions to be sequenced next week. In this lab I am not expecting to see Archaea species growing on the agar plates because Archaea typically grow in very extreme environments and an agar plate is not an extreme environment. At the beginning of the lab we looked at our Hay Infusion Culture from last week and saw that it had no particulate floating at the top, some of the water had evaporated, and the water overall was less murky than before. I hypothesize that our Hay Infusion Culture has changed because it has not been exposed to sunlight and so the microorganisms in the culture could have died off.
Materials and Methods: The procedure in this lab was to examine the plates under a microscope. Then specific colonies were swabbed for wet mounts. These were looked at under a microscope. Gram Stains of the same colonies were also created. First a loop was sterilized over a flame and a small amount of the colony was scraped and placed on a slide. A drop of water was added and then the slide was held over a flame for a few seconds until the culture had dried on the slide. The bacterial smear was then covered with crystal violet for about a minute. That was washed away and Gram's iodine was added to the slide. After a minute that was washed away and decolorizer was added for 30 seconds. then The smear was stained with safranin stain for 30 seconds. After being being washed the slides were looked at underneath a microscope.
Data and Observations: As shown in Table 1 found through the link below, the nutrient agar plate 10^-3 grew the most bacteria. It was the only plate that grew a lawn. Each of the plates with nutrient agar looked similar in terms of colors and sizes of colonies. The colonies were primarily yellow and white and most of the colonies appeared shiny. Some of the white fungus appeared as if it could be fungus because it was fuzzy. There was also some blackish purple colonies that appeared fuzzy also. All of the nutrient agar + tet also looked similar in terms of the color and size of colonies except for the nutrient + tet 10^-9. there was primarily white shiny colonies on the tet plates. On the tet [math]\displaystyle{ 10^-9 }[/math] there was one yellow colony.
Conclusions: It appeared that the yellow bacteria was affected by the tetracycline because there was only one colony found on the tet plates. The blackish purple bacterial colonies were also affected by the antibiotic because there were none found on the tet plates. The white bacteria, however, was not affected by the antibiotic. According to Ian Chopra and Marilyn Roberts, two leaders in microbial research, tetracycline inhibit protein synthesis in bacteria by binding to ribosomes. Tetracycline is a broad spectrum antibiotic and works against many Gram + and Gram - bacteria (Chopra & Roberts, 2001)The white bacteria must be resistant to tetracycline because it was able to grow on all of the plates.
Works Cited Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode Of Action, Applications, Molecular Biology, And Epidemiology Of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 232-260. Retrieved February 5, 2015.
1/29/15--Identifying Algae and Protists
Purpose: The purpose of this lab was to learn how to use a Dichotomous Key, to observe the Hay Infusion cultures from last week, and to prepare a series of serial dilutions to examine next week. I hypothesize that there will be more photosynthesizing organisms living at the top of the jar than at the bottom.
Materials and Methods: Liquid from both the top of the Hay Infusion Culture as well as from the bottom was used to create two wet mounts. They were labeled top and bottom respectively. The slides were examined under a microscope for living organisms. Once a living organism was found a Dichotomous Key was used to identify the organisms. The contents of the jar were mixed and serial dilutions were prepared by micropippeting 10mLs of the contents with sterile broth. Ten mLs of the sterile broth was taken and mixed in another tube of sterile broth. This process was repeated two more times. Ten mL of each tube was placed onto an agar plate and an antibacterial agar plate.
Data and Observations: The contents of our jar appeared to be brown. There was some particulate floating on the top, however, there was more particulate at the bottom of the jar. The bottom of the jar appeared sandy. From the bottom of the jar a Peranema, a Protea, Paramecium bursaria, and an Amoeba proteus were identified. The Peranema was motile and about 20µm. Peranema are not photosynthesizing. The protea was about 57 µm and was not motile. The Paramecium bursaria was about 50 µm. The paramecium is a ciliate and does not preform photosynthesis. The amoeba proteus was about 1,200 µm, did not appear motile, and is not photosynthesizing. From the top only one organism was found, the Spirostomum. The Spirostomum was 2 mm, is a cilliate, but did not appear to be moving, and does not preform photosynthesis.
Conclusions: I had thought there would be more photosynthesizing organisms living at the top of the jar, however, we did not find any photosynthesizing organisms at all. This could be because it was winter and most of the things that might normally be drawn to light are dead. Because we found so many more forms of life from the slide from the bottom, the data supports the fact that there are more life forms growing further away from a light source. It was very difficult to find life in our slides, especially in the slide from the top. This could mean the hay infusion was incorrectly or our sample just did not have many forms of life in it. If our Hay Infusion grew for another two months I would predict that the living organisms in it would grow and multiply. This could create selecctive pressures on the the organisms living towards the bottom because there might not be enough room.
FB
1/21/15--Niches at AU
Purpose:The purpose of this lab is to examine the diversity on AU's campus. Biotic and abiotic features will be looked at in a certain area of campus. A Hay Infusion will also be preformed. My group was given transect 3. I hypothesize that because it is winter very little will actually be growing and there will be no noticeable signs of living creatures on our transect.
Materials and Methods: First transect 3 was examined for biotic and abiotic elements. A map was drawn of the transect. A 50mL tube was used to collect dirt and vegetation from the transect. The sample was taken into the lab. Ten grams of the sample was measured put into a labeled plastic jar. Then 500mL of bottled water and .1 gm of dried milk was added to the jar. The lid was placed on the jar and the contents were mixed. The jar was left to sit with the lid off.
Data and Observations:Transect 3 is located in the garden near Bender arena. Most of the vegetation appeared dead. The biotic features of the transect are leaves, bushes, grasses, trees, and other plant life. The abiotic features of the transect are cigarette butts and trash, a lamp post, side walks, ice/snow, and soil.
Conclusions: The data supports my hypothesis because nothing in the transect appeared to be alive and well. All of the plants looked frosted over and there were no visible signs of life or creatures. I believe that as the weather warms up and spring hits our transect will have lots of growing vegetation and life forms such as squirrels and insects.
FB
1/21/15
Hello Open WetWare world.
FB