User:Peter Giang/Notebook/Biology 210 at AU

From OpenWetWare
Jump to navigationJump to search

March 5,2015 - Identifying Bacteria Through Constructing PCR for 16S Sequencing

Purpose

The purpose of this lab is to identify bacteria from our Hay infusion (obtained from our marsh transect)through establishing a PCR reaction, that is selectively amplifying the 16S rRNA gene (a well-studied primer in the scientific community) and then sequencing its DNA against known species of bacteria. Once we've identified the bacteria, we will be able to get a better understanding of some of its characteristic features including: growth patterns under antibiotic conditions, and cell morphology.

Materials and Methods

• Agar Petri Dish (4)

• Sterile Loop

• Sterile Tube with 100µL of Water

• Incubator

• Centrifuge

• 20µL of Primer/Water Mixture

• 5µL of Supernantant

• Agarose Gel

• Basic Local Alignment Search Tool

Error creating thumbnail: File missing


After setting up our PCR reaction and allowing one week for our product to form, we were able to successfully sequence our sample using Basic Local Alignment Search Tool (BLAST) whose results are supported by the National Institute of Health.

Step 1: Use https://clims3.genewiz.com/links.aspx?oId=4p6LZ4Isjwk=&ref=00 to retrieve sequencing reactions from the forward primer MB51.

Step 2: Download trace file for MB51 -For_16S by clicking on "View"

Step 3: Sequence File : MB51-For_16S.seq

MB51-For_16S_C07.ab1 GNNNNNNNNNNNNNNNNNNNNNNNTGCAGCCGAGCGGTAGAGATTCTTCGGATCTTGAGAGCGGCGTACGGGTGCGGAAC ACGTGTGCAACCTGCCTTTATCAGGGGGATAGCCTTTCGAAAGGAAGATTAATACCCCATAATATATTGAATGGCATCAT TTAATATTGAAAACTCCGGTGGATAGAGATGGGCACGCGCAAGATTAGATAGTTGGTGAGGTAACGGCTCACCAAGTCTA CGATCTTTAGGGGGCCTGAGAGGGTGATCCCCCACACTGGTACTGAGACACGGACCAGACTCCTACGGGAGGCAGCAGTG AGGAATATTGGACAATGGGTGCGAGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTT TTGTATAGGGATAAACCTAGATACGTGTATCTAGCTGAAGGTACTATACGAATAAGCACCGGCTAACTCCGTGCCAGCAN CCGCGGTAATACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGCGGATTTGTAAGTCAGTGNT GAAATCTCACAGCTTAACTGTGAAAACTGCCATTGATACTGCAAGTCTTGAGTGTTGTTGAATANCTGGAATAANTAGTG TANCGGTGAAATGCATANATTTTACTTANAACACCNNTGGCAAGGCNGGTTACTAANCACAACTGACGCTNATGGAN

Step 4: Navigate to BLAST at http://blast.ncbi.nlm.nih.gov/Blast.cgi

Step 5: Top results from sequences producing significant alignments: Chryseobacterium vietnamense strain GIMN1.005 16S ribosomal RNA gene, partial sequence



February 24, 2015 - Learning the Wonderful World of Invertebrates

Purpose The purpose of this lab is to study the soil invertebrates from our transect in order to better understand their role and function and how they evolved from simple organ systems to those of higher complexity. We hypothesize that there will be many invertebrates sampled from our leaf litter due to the large and nutrient rich resources from our march transect.

Materials and Methods (Procedure I: Acoelomates, Pseudocoelomates, and Coelomates)

• Dissecting scope

• Wet stain mount

Materials and Methods (Procedure II: Arthropods)

• Various organisms from each of the major classes: ararchnida, diplopoda, chilopoda, insect, and crustacea

Materials and Methods (Procedure III: Analyzing the Invertebrates Collected by the Berlese Funnel)

• Berlese Funnel

• Dissecting Microscope

• Figure 3: Common Soil Invertebrates Diagram

• Petri dish

• 10-15mL of Water

• Probe

Data and Observation (Procedure I: Acoelomates, Pseudocoelomates, and Coelomates)

The slender, and semi-transparent body and shape of the Planaria allows this organism to seemingly glide smoothly and evenly over or between environmental surfaces little to no apparent effort powered by cilia. The nematodes is seen with a slightly thinner and greater transparent cross-section allowing it to move faster through water surfaces in a undulating fashion. The last organism in this category, the Annelida has greater percentage of body composition and unlike the both the Planaria and the nematodes, movement involves extending the body, anchoring it to a surface, and contracting body muscles in an almost wavelike contraction/relaxation motion.

Data and Observation (Procedure II: Arthropods)

Figure 3: Common Invertebrates Soil Diagram

Organism #1 - Beetle Larva

Organism #2 - Springtail

Organism #3 - Soil Mite

Organism #4 - Nematode Worm

Organism #5 - Protura

Data and Observation (Procedure III: Analyzing the Invertebrates Collected with the Berlese Funnel)

Conclusion and Future Direction

The organisms obtained from our transect unfortunately did not support our initial hypothesis likely due to the extreme cold-weather conditions as many of the organisms inhabiting our transect may have died. It would be interesting to repeat the same experiment during a different time in the year (i.e. fall or summer months) to compare organisms that might be sampled or sample what organisms might be obtained from a different transect source (i.e. lake, pond, stream).

February 03, 2015 - Identifying Bacteria with DNA Sequences

Purpose The purpose of this lab is to better understand the different characteristics of bacteria by observing their morphology: growth and size, shape, motility, antibiotic-resistance, and lastly amplifying their growth (via PCR reactions) to better understand their DNA structure.

Although Archaea microorganisms can generally be found everywhere and are common in soil, I do not believe that this species would have grown in our agar plates because this organism has traditionally been very difficult to culture (Freeman, 2014).

As we observe our Hay Infusion Culture, it's evident that this medium has grown more murky in color, and much more odorous in smell. This makes sense because bacteria grows and reproduces very quickly and so over the span of a week, there was likely a significant growth of various organism contributing to both the smell and appearance in this culture.

There was a noticeably difference in bacterial growth of colonies seen between those that contained tetracycline and those that did not. The agar plates that did not contain tetracycline in the agar medium saw bacteria grew in large numbers to form lawns where hundreds to thousands of bacteria flourished. Agar plates that contained tetracycline in contrast, had significantly less total number of colony formation. The spectrum of activity of tetracyclines encompasses various protozoan parasites including: P. falciparum, Entamoeba histolytica, Giardia lamblia, Leishmania major, Trichomonas vaginalis, and Toxoplasma gondii (Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 65(2), 232–260. doi:10.1128/MMBR.65.2.232-260.2001)

Tetracyclines mechanism of action works by entering the bacterial cell wall in two ways: passive diffusion and an energy-dependent active transport system, mediated in a pH-dependent fashion. Once inside the cell, tetracyclines bind reversibly to the 30S ribosomal subunit at a position that blocks the binding of the aminoacyl-tRNA to the acceptor site on the mRNA-ribosome complex. Protein synthesis is ultimately inhibited, leading to a bacteriostatic effect (Chopra, I., & Roberts, M. (2001). Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance. Microbiology and Molecular Biology Reviews, 65(2), 232–260. doi:10.1128/MMBR.65.2.232-260.2001)


Materials and Methods

Hay Infusion Culture, Wet Mount Slides, Agar Plates (4), Inoculating Loop, Microscope, Staining Tray, Permanent Marker, Crystal Violet Stain, Gram Iodine Mordant, Water Bottle, Kimwipe, Sterile Tube, Centrifuge, PCR primer, Pipette, 95% alcohol


Finally able to get access to OWW! This forum is new to me, but I think I will enjoy it. Gone are the days of handwritten lab manuals..

PG