User:Ashish Bhattarai/Notebook/Biology 210 at AU: Difference between revisions
No edit summary |
No edit summary |
||
| (26 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
'''03/19/2015''' | |||
Zebrafish Development and Embryology | |||
Effects of Estrogen in Zebrafish Embryo-genesis | |||
Purpose: The growth of a living organism depends upon the nature and nurture. These two go hand in hand in the process of embryo-genesis. Embryogenesis is the process by which embryo of living organisms grow into a fully functional organism. The early stages of embryonic development are roughly the same in vertebrates and advanced invertebrates. Going back to the point of nature and nurture in the case of Embryogenesis, a good gene doesnot necessarily promise for the organism to thrive well and independently. Even if the genetic information it receives from its ancestor is good, if the condition at which it grows is not ideal for its growth, there is a very good chance that the organism cannot grow such that it is fully functional. In this experiment, embryogenesis of zebrafish is being studied. We are studying what effects, if any estrogen has on the growth of zebrafish. For that, zebrafish are separated into two different groups. | |||
i) Control | |||
ii) treated with estrogen | |||
Hypothesis: The zebrafish grown under estrogen will be larger and more developed than the zebrafish grown under the regular deerpark water. | |||
Materials and Methods: | |||
Materials: | |||
1) 40 Zebrafish embryos | |||
2) Estorgen solution | |||
3) Deerpark water | |||
4) Petri dish | |||
5) Microscope | |||
6) Dissecting scope | |||
7) Paraformaldehyde | |||
8) Pipette | |||
Zebrafish embryos are observed and their developmental stage on day 1. 20 healthy translucent embryos are put in two petri dish each. One of the petri dish is filled with 20mls of deerpark water and the other is filled with 20mls of estrogen. The dishes are left for zebrafish to grow and develop. | |||
Day 4-5: 10mls of water and empty egg cases are removed and 25mls of fresh water is added. | |||
Day 7: 5 mls of water is removed with egg cases and 5mls of fresh water and test solution is added to the respective dish. 3 embryos from the control and experimental groups are preserved in paraformaldehyde. | |||
Day 7-14: 5 mls of water and test solution is taken away and 10 mls more is added. After day 7, two drops of paramecium is added to both dish. Final observations are made at the end of day 14. | |||
Observation: | |||
Day 1: Translucent embryos of zebrafish put in petridish. The dead ones look fuzzy. The embryos looked like they were just past the bud stage and into 2-somite stage. Majority of yolk is present. | |||
Day 4: 13 zebrafish in the control dish were alive whereas 15 zebrafish in the estrogen (test) dish were alive. It means that 7 from the control dish were dead and 5 from the estrogen dish were dead. They were past the 36 hour stage and had tail structure coming out. All the alive ones were swimming rapidly. The body appeared a bit pigmented. None of the other development were apparent in day 4. | |||
Day 5: The number of alive zebrafish in day 5 were the same as the number alive in day 4. | |||
Day7: There were 15 zebrafish alive in the estrogen dish and 12 left in the control group. It means that between day 4 and day 7, 1 died from the control group and none died from the estrogen dish. The difference in the developmental stages between day 4 and day 7 was nothing; even when viewed under a microscope. Some zebrafish in both dish were very active whereas some appeared to be dead when it was just that they needed poking a bit to start the movement. | |||
Day 14: All of the zebrafish, from both control and test solution had died. There were several developmental differences apparent in the fish preserved in the paraformaldhehyde. The zebrafish in estrogen solution had enlarged organs such as heart, eyes and veins. The difference between tbe two samples are shown in the picture below. | |||
Zebrafish in estrogen | |||
[[Image:Fishy1.JPG]] | |||
Zebrafish under normal condition | |||
[[Image:FISHES2.jpeg]] | |||
Conclusion: The differences were apparent in the two pictures above. The fish grown in estrogen had larger organs when compared to the one grown in normal condition. But the differences does not necessarily show whether the size of the organs is beneficial or harmful. The experiment supports the hypothesis. Also both sets of fish died within the same time frame. But, if the fish were to survive for longer the accuracy regarding the effects of estrogen in embryogenesis of zebrafish would have been more apparent. | |||
AB | |||
'''03/05/2015''' | |||
Bacteria Identification | |||
Purpose: The main purpose of the experiment is to sequence the bacteria samples and identify the bacteria that was present in transect #5. | |||
Hypothesis: No hypothesis could be constructed regarding the identification of bacteria. | |||
Methods and materials: a single colony from each of the four chosen plates is transferred to 100 micro liters of water in a sterile tube. There are then incubated at 100 degree celsius for ten minutes while making sure that the tubes are floating in water in the heat block. The four samples are centrifuged for five minutes at the speed of 13,400 rpm. When the centrifugation occurs, 20 micro liters of primer water mixture is added to a labeled PCR tube and the PCR bead is dissolved. Five micro liters of supernatant from the centrifuged samples are added to the PCR tubes accordingly. The four tubes are then placed in the PCR machine. | |||
Next week, gel was run and the bacteria from just one sample (#4) was sequenced. | |||
Data and Observations: | |||
Sequence | |||
NNNNNNNNNNGGNNNNNNNNNNNGCAGTCGAGCGGATGACGGGAGCTTGCTCCTTGATTCAGCGGCGGACGGGTGAGTAA TGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCA GGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGAC GATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGG GGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTA AGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCA GCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTG GATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTC CTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAN GTGCGAAAGCGTGGGGAGCAAACAGGATTANNATACCCTGGTAGTCCACGCCGTNNCGATGTCAACTAGCCNTTGGAATC CTTGAGATTTTAGTGGCGCANCTNACGCATTAAGTTGACCGCCTGGGGAGTACNNGCCGCAAGGTTAGANACTCNNTGAA TTGACNGGGCCCGCACAAGCGGTGGANCATGTGGTTTNAATTCNAANCAACNCNANACCTTACCNNGCCTTGACATGCNN ANNNCTTTCNNGANNTGGATTGGTGCCNNNNNNNNCTCTGACACANGTGCTGCATGGCTGTCNNNNNCTCGTGTCNNGAN ATNNTGGNNNNNTCNNNNTNNCNNNCNNNNNCCNNNN | |||
[[Image:Ashish_.png]] | |||
Conclusion: Thus it can be concluded that the bacteria that was in the plates and in the transect #5 is Pseudomonas sp. YP19. | |||
'''02/18/2015''' | |||
'''Vertebrates Classification''' | |||
Purpose: The main purpose of the experiment is to study the vertebrates present in the transect assigned to and make a food web to describe the relationship between the abiotic and biotic factors in this environment. | |||
Hypothesis: There won't be as many vertebrates in this environment. | |||
Methods and Materials: Transect, a good keen eyes. | |||
The method involved watching the premises and see what the vertebrates did in the environment and what vertebrates were actually there. | |||
The table below shows the vertebrates present in the transect. | |||
[[Image:Screen Shot 2015-02-26 at 1.14.19 PM.png]] | |||
The source used for classification of the animals is: http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180175 | |||
The following diagram shows the food web and relationships between the vertebrates and other animals and abiotic factors in the environment. | |||
[[Image: 11004866_1007291439300438_1987658_n.jpg]] | |||
Conclusion: It was very difficult to find many vertebrates in the environment where human interaction is to extreme. Therefore the hypothesis cannot be rejected. | |||
AB | |||
'''02/15/2015''' | |||
'''Classification of Invertebrates''' | |||
Purpose: The main purpose of this experiment is to study the importance of invertebrates in an ecosystem and look at the invertebrates that are present in the transect we are assigned to (Transect #5, manicured grassland). But first, we are studying already present samples of invertebrates and how they move. | |||
Hypothesis: Arthropods make the majority of invertebrates in our transect. | |||
Methods and Materials: During the last experiment, we made a Berlese funnel with ethanol on a test tube at the end of the funnel. Ethanol helped preserve the insects present in the Berlese funnel. The funnel was kept under a bright source of light which drove away the insects and other invertebrates towards the end of the funnel and into the test tube with ethanol. We took away the test tube with ethanol and poured the contents into two petri dishes. The contents in those petri dishes were viewed under dissecting microscope. We also looked at three live specimens of invertebrates and recorded the movement and its relation to the body structure. | |||
Observations: When we poured the contents of test tube into petri dishes and viewed under the dissecting microscope there was only one invertebrate present. Because of that we had to look at other samples from peers who had the same transect. Viewing all the other samples, we found the following invertebrates in our transect. | |||
[[Image:Invertebrates_.pdf]] | |||
Looking at the table above it can be said that soil mites are the smallest of all the invertebrates that were found in our transect. The largest invertebrates are the Springtail X. The size of invertebrates ranged from 0.1mm to 0.7mm. Proturan X (Primitive Insect) was the most abundant. There were six Proturan X in the sample. | |||
Conclusion: It can be concluded that insects are the invertebrates that are most present in the sample and thus the hypothesis that arthropods make the majority of invertebrates in our transect cannot be rejected. | |||
AB | |||
---- | |||
'''02/10/2015''' | |||
'''Diversity in Plant Kingdom''' | |||
Purpose: The main purpose of the experiment is to study the characteristics and diversity of plants in the AU community. In this experiment we are studying the plants in the transect we were assigned to (Transect #5, Manicured grassland). Along with understanding the characteristics of plants in our sample environment, we are looking at how fungi plays an important role in an ecosystem. | |||
Hypothesis: Most of the plants present in the transect are well vascularized. | |||
Methods and Materials: At the start of the class we went to our transect in order to collect sample plants from the transect. Also, we brought some leaves from the transect and some materials so that we could make a Berlese funnel for collecting invertebrates. The sample plants were studied in the lab and several of their distinct characteristics were studied. The characteristics are used to distinguish the plants on the basis of the way of reproduction, dicot or monocot and types of vascularization present in the plants. The sample plants are also viewed under the microscope. | |||
Another thing that was done in the lab is running the gel electrophoresis for the PCR product of 16S rRNA in bacteria from the different bacterial plates. | |||
Observation : | |||
The picture below shows the general area in the transect from where the sample plants were taken. | |||
[[Image:10965681_1002966036399645_2032382824_n.jpg]] | |||
Table 1 below shows the description of all the plants that were collected as samples. | |||
[[Image:Screen_Shot_2015-02-12_at_12.10.49_PM.png]] | |||
[[Image:Screen_Shot_2015-02-12_at_12.26.21_PM.png]] | |||
The image above is how the plants were identified to be in certain groups. | |||
[[Image:Sample 1.pdf]] | |||
Sample 1. pdf is a file that has pictures of all the sample plants in the transect. | |||
[http://www.ellenjmchenry.com/homeschool-freedownloads/lifesciences-games/documents/BotanySecondChapter_000.pdf] | |||
[http://en.wikipedia.org/wiki/Elm] | |||
The above link are the sources that were used in classification of the plants. | |||
Fungi sporangia are decomposers which release carbon dioxide into the atmosphere and nitrogenous materials into the soil and surface waters. They are a very important part of ecosystem as both substances they give out such as carbon dioxide and nitrogen is used by plants to generate carbohydrates. It helps drive the food chain. They are saprobes and feed on non living organic matters.Looking at the samples from the transect, it can easily be determined that none of the samples were fungus. | |||
Conclusion: The observation shows that the hypothesis is supported. Most of the plants in this transect are well vascularized. Also, most of the plants are dicots and angiosperms. The classification based on monocot and dicot was know based on the leaves structures. The three plants that were dicot had broad leaves with network of veins whereas the monocots such as weed and grass have long slender leaves with parallel veins. | |||
AB | |||
'''02/05/2015''' | |||
'''Identification of Bacteria with DNA sequences''' | |||
Purpose: This experiment is also a part of the observation of the transect we have been assigned to. The transect that we are working on is Transect #5; which is a manicured grassland. In the last experiment we observed protists that are present in the transect. In this experiment, we are looking at the bacteria present in transect #5. Along with looking at the bacteria present, we are also looking to understand the characteristics of bacteria and are using DNA sequences of bacteria to identify species of bacteria. We are also looking at how antibiotic affects certain bacteria whereas some bacteria are resistant to antibiotic. Along with studying bacteria and their characteristics, we are looking at our ecosystem for one last time and making observations about how it has changed within the week. | |||
Hypothesis: There will be more bacteria in the plates without antibiotic then in the ones with antibiotic. | |||
Materials/Methods: The "Hay Infusion Culture" is observed for the very last time and then discarded. We obtain the agar bacterial plates that were made a week ago through the process of serial dilution to observe the growth of bacteria in each plates (with different characteristics). Each plate differs with the other; whether it is a plate with antibiotic or without antibiotic or there is different concentration of bacteria. Number of colonies of bacteria in each of the eight plates are counted and recorded. Four out of the eight plates are chosen and the description of how the colonies look (diameter, color, shape and texture) is recorded. The above process is conducted under a microscope. After the general characteristics of colonies are recorded, wet mount of the bacteria present in the four plates are made to be observed under the microscope. This time, characteristics of bacterial cells themselves are observed and recorded. The cell shapes and motility of bacterial cells are recorded. After the wet mounts of bacterial cells from each of the 4 plates are observed, gram staining procedure is done. (The four plates chosen are two from agar only plates and two of agar+tetracyclin plates). | |||
Gram stain procedure: | |||
A loop is sterilized over a flame and a tiny amount of bacteria is scraped off a plate. That tiny amount of bacteria is then mixed with a drop of water. The slide is heat fixed as it is passed through the flame until dry. The bacterial smear is covered with crystal violet for a minute and then rinsed off with water. The bacterial smear is then covered with Gram's iodine mordant for a minute and rinsed off with water. The smear is decolorized using 95% alcohol. It is then covered with safranin for about 30 seconds and rinsed again with water. Excess water is blotted using wipes and the slide is allowed to air dry. After the slide is air dried, it is viewed under a microscope. This process is performed for all four plates being used. | |||
After the gram stain procedure is completed and the samples are viewed under microscope, a single colony from each of the four chosen plates is transferred to 100 micro liters of water in a sterile tube. There are then incubated at 100 degree celsius for ten minutes while making sure that the tubes are floating in water in the heat block. The four samples are centrifuged for five minutes at the speed of 13,400 rpm. When the centrifugation occurs, 20 micro liters of primer water mixture is added to a labeled PCR tube and the PCR bead is dissolved. Five micro liters of supernatant from the centrifuged samples are added to the PCR tubes accordingly. The four tubes are then placed in the PCR machine. | |||
Observation: | |||
The hay infusion culture is brought to the table. The smell is not as strong as the last time it was observed. The water level has gone down a lot (evaporation) which means that there is less carrying capacity on the ecosystem. The plant matters have almost clumped together. Although the smell is not as strong, it smells like as if there is some salt present in it (of course due to the minerals found in soil and plant matters). There is no any clear zone in the culture. The weaker smell is most likely because there are lower number of microorganisms in the eco-system. The carrying capacity has decreased and thus there are lower number of microorganisms. | |||
The environment and the eco system that we are dealing with does not have any extremities because the pH is not high, the temperature is like that of a room temperature and salt level is normal as well. Because of the above conditions, it is very likely that Archae species will not have grown on the agar plates. Archae are mostly found in area with extremities related to pH, temperature and salt level. The table linked shows the number of bacterial colonies that are present in each of the eight plates. | |||
Table 1: [[Image:Screen Shot 2015-02-05 at 1.09.58 PM.png]] | |||
One of the major differences between the plates with just nutrition agar and the plates with agar and tetracycline is the number of colonies present in the plates. The plates with just the nutrient has much larger quantity of bacterial colonies than the ones with agar and tetracycline. This shows that tetracycline causes bacteria to die. It was also noted that some of the plates with just agar had some white colonies whereas all of the plates with tetracycline had no any indication of white colonies. These white colonies are fungi. The presence of fungi in the plates with nutrient but the lack of presence of fungi in the plates with tetracycline shows that tetracycline controls the growth of fungi. Also, all the tetracycline plates had just staphylococci bacteria but the plates with agar had some rod shaped bacteria as well. Further information about the presence of such bacteria and their characterization is shown in Table 2: Bacteria Characterization below. We were not able to take pictures of the plates under microscope but the descriptions are all below. | |||
Tetracycline bind to the 30S subunit of the bacterial ribosome. They prevent the transfer of activated amino acids to the ribosome, so protein synthesis is halted (''1'').It means that bacteria can not go through with the process of cell division and thus won't be able to give rise to the next generation. Once the 1st generation dies there are no more of such bacteria. | |||
Table 2: Bacteria Characterization [[Image:Screen Shot 2015-02-05 at 1.10.27 PM.png]] | |||
All the bacterial colonies are in the picture below with the descriptions of four chosen plates in Table 2. | |||
[[Image:Ashish12.jpg.jpg]] | |||
Conclusion: The data regarding the plates and antibiotic resistance shows that the hypothesis cannot be rejected. It is so because the plates with just nutrient had more bacterial colonies than the plates containing tetracycline and nutrient. | |||
Reference: | |||
''1'' Antibiotics: Antibacterial Agents. (2014, May 8). Retrieved February 5, 2015, from http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/A/Antibiotics.html | |||
AB | |||
'''01/29/2015''' | '''01/29/2015''' | ||
| Line 4: | Line 211: | ||
Purpose: In the last experiment, we observed an environment within American University's ground and obtained sample to make a hay infusion culture. The main purpose of this particular experiment is to see all the biological lives that exist in this particular transect (Transect #5; Manicured Grassland). Using a microscope, we will be identifying protists and algae present in transect #5. We are looking where these protists and algae (near the plant materials or away from plant materials) are present. | Purpose: In the last experiment, we observed an environment within American University's ground and obtained sample to make a hay infusion culture. The main purpose of this particular experiment is to see all the biological lives that exist in this particular transect (Transect #5; Manicured Grassland). Using a microscope, we will be identifying protists and algae present in transect #5. We are looking where these protists and algae (near the plant materials or away from plant materials) are present. | ||
Hypothesis: Some algae and protists are present in the Hay Infusion culture. | |||
Materials/ Methods : The "Hay Infusion Culture" that was made in the last experiment is considered an ecosystem. The 500mls of water and vegetation mixture consists of many different types of niches. Some protists and algae prefer plant materials for food whereas some tend to be away from the plant materials. For this experiment we are looking at the protists that are present in two different niches/conditions. The ecosystem (Hay Infusion Culture) is brought to the table. With a pipette we took 2 samples altogether from 2 different niches (one from near the plant materials (top of the culture) and one from away the plant materials (middle of the culture towards the side) ). We prepared 2 microscopic slides with 2 drops of mixture in each slide and added a liquid agent that slows down the protists so that they can be observed well. Without the slowing agent, protists move very fast and are difficult to track down and observe their characteristics. Using the ocular micrometer in the microscope the size of protists were measured. Also a Dichotomous key was used to identify the protists present in the sample. The characteristics of protists were used as reference to work with dichotomous key which asked questions and gave 2 options every time thus leading to the final observation that led to identification of protists. | Materials/ Methods : The "Hay Infusion Culture" that was made in the last experiment is considered an ecosystem. The 500mls of water and vegetation mixture consists of many different types of niches. Some protists and algae prefer plant materials for food whereas some tend to be away from the plant materials. For this experiment we are looking at the protists that are present in two different niches/conditions. The ecosystem (Hay Infusion Culture) is brought to the table. With a pipette we took 2 samples altogether from 2 different niches (one from near the plant materials (top of the culture) and one from away the plant materials (middle of the culture towards the side) ). We prepared 2 microscopic slides with 2 drops of mixture in each slide and added a liquid agent that slows down the protists so that they can be observed well. Without the slowing agent, protists move very fast and are difficult to track down and observe their characteristics. Using the ocular micrometer in the microscope the size of protists were measured. Also a Dichotomous key was used to identify the protists present in the sample. The characteristics of protists were used as reference to work with dichotomous key which asked questions and gave 2 options every time thus leading to the final observation that led to identification of protists. | ||
Procedure III: After observing the hay infusion culture we prepared serial dilutions to examine the mixture of bacterial species present in the culture. Four tubes of 10mls sterile broth are labelled with numbers 10^-2, 10^-4, 10^-6, 10^-8. We got 4 nutrient agar plate and 4 agar plus tetracycline plates. The plates were labelled accordingly with whether tetracycline was present or not and by their serial dilutions. Hay infusion culture is swirled and serial dilution is performed. After serial dilutions are made, 100 microliter of broth is placed in the agar plates and plates with tetracyclin according to their concentration with a 100 microliter pipette. The liquid is well spread on the agar side. The lids of plates are closed and will be incubated at room temperature for a week. Serial dilution and procedure explained in the image below. | |||
[[Image:10949766_995619640467618_1867961951_n.jpg]] | |||
Observation: As the "Hay Infusion Culture" is brought to the table, the first observation we made was the smell. The culture had a very strong smell. It almost had a rotten smell. The smell was like that of a sewer or human wasteland. The top of the culture had cell membrane like gelatinous texture up on the top. It was like the layer of fat in a boiled fatty milk. The overall appearance of the appearance was brownish. The middle part of the ecosystem is clearer than the top and the very bottom. The top of the culture had grass on the top and looked like as if they are growing on the top (they are bunched up all together). The grass bunch was green in color. The top has some dirt and wood chips present in it. The middle is almost clear but does have some grass and plant material floating towards the center of the jar. The bottom contains soil and plant matters such as leaves and chunks of wood and mulch. | Observation: As the "Hay Infusion Culture" is brought to the table, the first observation we made was the smell. The culture had a very strong smell. It almost had a rotten smell. The smell was like that of a sewer or human wasteland. The top of the culture had cell membrane like gelatinous texture up on the top. It was like the layer of fat in a boiled fatty milk. The overall appearance of the appearance was brownish. The middle part of the ecosystem is clearer than the top and the very bottom. The top of the culture had grass on the top and looked like as if they are growing on the top (they are bunched up all together). The grass bunch was green in color. The top has some dirt and wood chips present in it. The middle is almost clear but does have some grass and plant material floating towards the center of the jar. The bottom contains soil and plant matters such as leaves and chunks of wood and mulch. | ||
The organisms/protists present nearby the plant matters and nearby just the water source are more likely to differ from each other. It is so because, the ones in just water obtain their nutrients from water because of which the way they feed is most likely to differ from the ones that feed on plants and plant materials. Water, with increase in temperature will most likely evaporate. The evaporation of water in the next two months mean that the protists that rely solely on the water for their habitat and feeding will have lower area to live. With the decrease in area to leave the carrying capacity of this particular niche will decrease thus causing the lower number of protists present solely in water. The decrease of such organisms is most likely due to the lack of food source. | [[Image:Top view.jpg]] | ||
[[Image:Ecosystem.jpg]] | |||
The organisms/protists present nearby the plant matters and nearby just the water source are more likely to differ from each other. It is so because, the ones in just water obtain their nutrients from water because of which the way they feed is most likely to differ from the ones that feed on plants and plant materials. Water, with increase in temperature will most likely evaporate. The evaporation of water in the next two months mean that the protists that rely solely on the water for their habitat and feeding will have lower area to live. With the decrease in area to leave the carrying capacity of this particular niche will decrease thus causing the lower number of protists present solely in water. The decrease of such organisms is most likely due to the lack of food source. The following organisms are seen under the microscope from two different niches. | |||
[[Image:10957548 995602057136043 1345349461 n.jpg]] | |||
Protist #1 observed in Niche 1, nearby plant matters is Paramecium Aurelia. When observed under 10x magnification under the ocular microscope, it was 12 ocular spaces large which translates to 120 micrometer in length. It is ciliated and moved relatively fast when compared to other organisms. Also, its general characteristic for its color is clear/white. Protist. | |||
Protist #2 observed in this Niche 1, nearby plant matters is Colpidium, which when observed under 40x magnification is 20 ocular spaces large. The size translates to 50 micrometer in length. It is oval in shape and is consistent with clear color. Compared to Paramecium, the movement is rather stagnant and very random with no relative pattern. Protist | |||
Protist #3 observed in this Niche 1, nearby plant matters is "unknow". Even with the dichotomous key this was rather unidentifiable. Its characteristics are that it changes shape from round to being oval time and again. There are a lot of organelles like structures inside the cell. It is 25 ocular spaces at 40x magnification. It is ciliated and there is no any distinct motion and moves around circle as it changes shape. Protist. | |||
[[Image:10954725_995602100469372_539608022_n.jpg]] | |||
Protist #1 observed in this Niche 2, away from plant matters is Colpidium, which when observed under 40x magnification is 20 ocular spaces large. The size translates to 50 micrometer in length. It is oval in shape and is consistent with clear color. Compared to Paramecium, the movement is rather stagnant and very random with no relative pattern. Protist | |||
Protist #2 observed in this Niche 2, away from plant matters is a Chlamydomonas. It is green in color (can photosynthesize). At 40x magnification it is 6 ocular spaces in size and translates to 15 micrometer in length. Its general characteristic is the presence of 2 flagellum and single celled. It is a kind of algae and can photosynthesize. It is motile. | |||
Protist #3 observed in this Niche 2, away from plant matters is Gonium. It was very easy to distinguish because of the colonial shape it was in. Greenish in color, the colony was about 20 ocular spaces in size and round. The 20 ocular spaces at 40x translates to 50 micrometer in length. It is a kind of algae and can photosynthesize. They move as a group. | |||
Conclusion: It can be concluded that the transect #5 do have a lot of organisms. Because we were able to see some organisms (protists and algae) it helps to the support the hypothesis that the hay transfusion culture has some protists and algae which ultimately leads to conclude that there are protists and algae present in the transect #5. | |||
AB | |||
| Line 39: | Line 268: | ||
Data/ Observation: The location of this transect is around the Eric A Friedham Quadrangle seating area in the main quad of American University. The transect is looking at Batelle with back towards Hurst building. To the right of transect is Kay Spiritual Center. The transect includes a small part of the seating area itself. When looking at Batelle with back towards Hurst, the transect is to the right of the middle of the seating area that is lead by a path. The transect is to the right. The transect incorporates dead bushes and shrubs with wilted leaves lying on the grassy manicured land. The shrubs are growing on the mulch which is one of the features of the transect itself. The mulch area looks fertile and promises a lot of microbes and bacteria.There are two different kinds of bushes. | Data/ Observation: The location of this transect is around the Eric A Friedham Quadrangle seating area in the main quad of American University. The transect is looking at Batelle with back towards Hurst building. To the right of transect is Kay Spiritual Center. The transect includes a small part of the seating area itself. When looking at Batelle with back towards Hurst, the transect is to the right of the middle of the seating area that is lead by a path. The transect is to the right. The transect incorporates dead bushes and shrubs with wilted leaves lying on the grassy manicured land. The shrubs are growing on the mulch which is one of the features of the transect itself. The mulch area looks fertile and promises a lot of microbes and bacteria.There are two different kinds of bushes. | ||
[[Image: | [[Image:10950093 993846653978250 59493695 n.jpg]] | ||
The biotic (living) factors of the transect are as follows: | The biotic (living) factors of the transect are as follows: | ||
Latest revision as of 02:19, 20 March 2015
03/19/2015 Zebrafish Development and Embryology Effects of Estrogen in Zebrafish Embryo-genesis
Purpose: The growth of a living organism depends upon the nature and nurture. These two go hand in hand in the process of embryo-genesis. Embryogenesis is the process by which embryo of living organisms grow into a fully functional organism. The early stages of embryonic development are roughly the same in vertebrates and advanced invertebrates. Going back to the point of nature and nurture in the case of Embryogenesis, a good gene doesnot necessarily promise for the organism to thrive well and independently. Even if the genetic information it receives from its ancestor is good, if the condition at which it grows is not ideal for its growth, there is a very good chance that the organism cannot grow such that it is fully functional. In this experiment, embryogenesis of zebrafish is being studied. We are studying what effects, if any estrogen has on the growth of zebrafish. For that, zebrafish are separated into two different groups. i) Control ii) treated with estrogen
Hypothesis: The zebrafish grown under estrogen will be larger and more developed than the zebrafish grown under the regular deerpark water.
Materials and Methods:
Materials: 1) 40 Zebrafish embryos 2) Estorgen solution 3) Deerpark water 4) Petri dish 5) Microscope 6) Dissecting scope 7) Paraformaldehyde 8) Pipette
Zebrafish embryos are observed and their developmental stage on day 1. 20 healthy translucent embryos are put in two petri dish each. One of the petri dish is filled with 20mls of deerpark water and the other is filled with 20mls of estrogen. The dishes are left for zebrafish to grow and develop.
Day 4-5: 10mls of water and empty egg cases are removed and 25mls of fresh water is added.
Day 7: 5 mls of water is removed with egg cases and 5mls of fresh water and test solution is added to the respective dish. 3 embryos from the control and experimental groups are preserved in paraformaldehyde.
Day 7-14: 5 mls of water and test solution is taken away and 10 mls more is added. After day 7, two drops of paramecium is added to both dish. Final observations are made at the end of day 14.
Observation:
Day 1: Translucent embryos of zebrafish put in petridish. The dead ones look fuzzy. The embryos looked like they were just past the bud stage and into 2-somite stage. Majority of yolk is present.
Day 4: 13 zebrafish in the control dish were alive whereas 15 zebrafish in the estrogen (test) dish were alive. It means that 7 from the control dish were dead and 5 from the estrogen dish were dead. They were past the 36 hour stage and had tail structure coming out. All the alive ones were swimming rapidly. The body appeared a bit pigmented. None of the other development were apparent in day 4.
Day 5: The number of alive zebrafish in day 5 were the same as the number alive in day 4.
Day7: There were 15 zebrafish alive in the estrogen dish and 12 left in the control group. It means that between day 4 and day 7, 1 died from the control group and none died from the estrogen dish. The difference in the developmental stages between day 4 and day 7 was nothing; even when viewed under a microscope. Some zebrafish in both dish were very active whereas some appeared to be dead when it was just that they needed poking a bit to start the movement.
Day 14: All of the zebrafish, from both control and test solution had died. There were several developmental differences apparent in the fish preserved in the paraformaldhehyde. The zebrafish in estrogen solution had enlarged organs such as heart, eyes and veins. The difference between tbe two samples are shown in the picture below.
Zebrafish in estrogen
Zebrafish under normal condition
Conclusion: The differences were apparent in the two pictures above. The fish grown in estrogen had larger organs when compared to the one grown in normal condition. But the differences does not necessarily show whether the size of the organs is beneficial or harmful. The experiment supports the hypothesis. Also both sets of fish died within the same time frame. But, if the fish were to survive for longer the accuracy regarding the effects of estrogen in embryogenesis of zebrafish would have been more apparent.
AB
03/05/2015
Bacteria Identification
Purpose: The main purpose of the experiment is to sequence the bacteria samples and identify the bacteria that was present in transect #5.
Hypothesis: No hypothesis could be constructed regarding the identification of bacteria.
Methods and materials: a single colony from each of the four chosen plates is transferred to 100 micro liters of water in a sterile tube. There are then incubated at 100 degree celsius for ten minutes while making sure that the tubes are floating in water in the heat block. The four samples are centrifuged for five minutes at the speed of 13,400 rpm. When the centrifugation occurs, 20 micro liters of primer water mixture is added to a labeled PCR tube and the PCR bead is dissolved. Five micro liters of supernatant from the centrifuged samples are added to the PCR tubes accordingly. The four tubes are then placed in the PCR machine.
Next week, gel was run and the bacteria from just one sample (#4) was sequenced.
Data and Observations:
Sequence
NNNNNNNNNNGGNNNNNNNNNNNGCAGTCGAGCGGATGACGGGAGCTTGCTCCTTGATTCAGCGGCGGACGGGTGAGTAA TGCCTAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGCA GGGGACCTTCGGGCCTTGCGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGGGGTAATGGCTCACCAAGGCGAC GATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGCAGTGG GGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTA AGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTAACTCTGTGCCA GCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTG GATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTACGGTAGAGGGTGGTGGAATTTC CTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCTGGACTGATACTGACACTGAN GTGCGAAAGCGTGGGGAGCAAACAGGATTANNATACCCTGGTAGTCCACGCCGTNNCGATGTCAACTAGCCNTTGGAATC CTTGAGATTTTAGTGGCGCANCTNACGCATTAAGTTGACCGCCTGGGGAGTACNNGCCGCAAGGTTAGANACTCNNTGAA TTGACNGGGCCCGCACAAGCGGTGGANCATGTGGTTTNAATTCNAANCAACNCNANACCTTACCNNGCCTTGACATGCNN ANNNCTTTCNNGANNTGGATTGGTGCCNNNNNNNNCTCTGACACANGTGCTGCATGGCTGTCNNNNNCTCGTGTCNNGAN ATNNTGGNNNNNTCNNNNTNNCNNNCNNNNNCCNNNN
Conclusion: Thus it can be concluded that the bacteria that was in the plates and in the transect #5 is Pseudomonas sp. YP19.
02/18/2015
Vertebrates Classification
Purpose: The main purpose of the experiment is to study the vertebrates present in the transect assigned to and make a food web to describe the relationship between the abiotic and biotic factors in this environment.
Hypothesis: There won't be as many vertebrates in this environment.
Methods and Materials: Transect, a good keen eyes.
The method involved watching the premises and see what the vertebrates did in the environment and what vertebrates were actually there.
The table below shows the vertebrates present in the transect.
The source used for classification of the animals is: http://www.itis.gov/servlet/SingleRpt/SingleRpt?search_topic=TSN&search_value=180175
The following diagram shows the food web and relationships between the vertebrates and other animals and abiotic factors in the environment.
Conclusion: It was very difficult to find many vertebrates in the environment where human interaction is to extreme. Therefore the hypothesis cannot be rejected.
AB
02/15/2015
Classification of Invertebrates
Purpose: The main purpose of this experiment is to study the importance of invertebrates in an ecosystem and look at the invertebrates that are present in the transect we are assigned to (Transect #5, manicured grassland). But first, we are studying already present samples of invertebrates and how they move.
Hypothesis: Arthropods make the majority of invertebrates in our transect.
Methods and Materials: During the last experiment, we made a Berlese funnel with ethanol on a test tube at the end of the funnel. Ethanol helped preserve the insects present in the Berlese funnel. The funnel was kept under a bright source of light which drove away the insects and other invertebrates towards the end of the funnel and into the test tube with ethanol. We took away the test tube with ethanol and poured the contents into two petri dishes. The contents in those petri dishes were viewed under dissecting microscope. We also looked at three live specimens of invertebrates and recorded the movement and its relation to the body structure.
Observations: When we poured the contents of test tube into petri dishes and viewed under the dissecting microscope there was only one invertebrate present. Because of that we had to look at other samples from peers who had the same transect. Viewing all the other samples, we found the following invertebrates in our transect.
Looking at the table above it can be said that soil mites are the smallest of all the invertebrates that were found in our transect. The largest invertebrates are the Springtail X. The size of invertebrates ranged from 0.1mm to 0.7mm. Proturan X (Primitive Insect) was the most abundant. There were six Proturan X in the sample.
Conclusion: It can be concluded that insects are the invertebrates that are most present in the sample and thus the hypothesis that arthropods make the majority of invertebrates in our transect cannot be rejected.
AB
02/10/2015
Diversity in Plant Kingdom
Purpose: The main purpose of the experiment is to study the characteristics and diversity of plants in the AU community. In this experiment we are studying the plants in the transect we were assigned to (Transect #5, Manicured grassland). Along with understanding the characteristics of plants in our sample environment, we are looking at how fungi plays an important role in an ecosystem.
Hypothesis: Most of the plants present in the transect are well vascularized.
Methods and Materials: At the start of the class we went to our transect in order to collect sample plants from the transect. Also, we brought some leaves from the transect and some materials so that we could make a Berlese funnel for collecting invertebrates. The sample plants were studied in the lab and several of their distinct characteristics were studied. The characteristics are used to distinguish the plants on the basis of the way of reproduction, dicot or monocot and types of vascularization present in the plants. The sample plants are also viewed under the microscope.
Another thing that was done in the lab is running the gel electrophoresis for the PCR product of 16S rRNA in bacteria from the different bacterial plates.
Observation :
The picture below shows the general area in the transect from where the sample plants were taken.
Table 1 below shows the description of all the plants that were collected as samples.
The image above is how the plants were identified to be in certain groups.
Sample 1. pdf is a file that has pictures of all the sample plants in the transect.
[1]
[2]
The above link are the sources that were used in classification of the plants.
Fungi sporangia are decomposers which release carbon dioxide into the atmosphere and nitrogenous materials into the soil and surface waters. They are a very important part of ecosystem as both substances they give out such as carbon dioxide and nitrogen is used by plants to generate carbohydrates. It helps drive the food chain. They are saprobes and feed on non living organic matters.Looking at the samples from the transect, it can easily be determined that none of the samples were fungus.
Conclusion: The observation shows that the hypothesis is supported. Most of the plants in this transect are well vascularized. Also, most of the plants are dicots and angiosperms. The classification based on monocot and dicot was know based on the leaves structures. The three plants that were dicot had broad leaves with network of veins whereas the monocots such as weed and grass have long slender leaves with parallel veins.
AB
02/05/2015
Identification of Bacteria with DNA sequences
Purpose: This experiment is also a part of the observation of the transect we have been assigned to. The transect that we are working on is Transect #5; which is a manicured grassland. In the last experiment we observed protists that are present in the transect. In this experiment, we are looking at the bacteria present in transect #5. Along with looking at the bacteria present, we are also looking to understand the characteristics of bacteria and are using DNA sequences of bacteria to identify species of bacteria. We are also looking at how antibiotic affects certain bacteria whereas some bacteria are resistant to antibiotic. Along with studying bacteria and their characteristics, we are looking at our ecosystem for one last time and making observations about how it has changed within the week.
Hypothesis: There will be more bacteria in the plates without antibiotic then in the ones with antibiotic.
Materials/Methods: The "Hay Infusion Culture" is observed for the very last time and then discarded. We obtain the agar bacterial plates that were made a week ago through the process of serial dilution to observe the growth of bacteria in each plates (with different characteristics). Each plate differs with the other; whether it is a plate with antibiotic or without antibiotic or there is different concentration of bacteria. Number of colonies of bacteria in each of the eight plates are counted and recorded. Four out of the eight plates are chosen and the description of how the colonies look (diameter, color, shape and texture) is recorded. The above process is conducted under a microscope. After the general characteristics of colonies are recorded, wet mount of the bacteria present in the four plates are made to be observed under the microscope. This time, characteristics of bacterial cells themselves are observed and recorded. The cell shapes and motility of bacterial cells are recorded. After the wet mounts of bacterial cells from each of the 4 plates are observed, gram staining procedure is done. (The four plates chosen are two from agar only plates and two of agar+tetracyclin plates).
Gram stain procedure: A loop is sterilized over a flame and a tiny amount of bacteria is scraped off a plate. That tiny amount of bacteria is then mixed with a drop of water. The slide is heat fixed as it is passed through the flame until dry. The bacterial smear is covered with crystal violet for a minute and then rinsed off with water. The bacterial smear is then covered with Gram's iodine mordant for a minute and rinsed off with water. The smear is decolorized using 95% alcohol. It is then covered with safranin for about 30 seconds and rinsed again with water. Excess water is blotted using wipes and the slide is allowed to air dry. After the slide is air dried, it is viewed under a microscope. This process is performed for all four plates being used.
After the gram stain procedure is completed and the samples are viewed under microscope, a single colony from each of the four chosen plates is transferred to 100 micro liters of water in a sterile tube. There are then incubated at 100 degree celsius for ten minutes while making sure that the tubes are floating in water in the heat block. The four samples are centrifuged for five minutes at the speed of 13,400 rpm. When the centrifugation occurs, 20 micro liters of primer water mixture is added to a labeled PCR tube and the PCR bead is dissolved. Five micro liters of supernatant from the centrifuged samples are added to the PCR tubes accordingly. The four tubes are then placed in the PCR machine.
Observation: The hay infusion culture is brought to the table. The smell is not as strong as the last time it was observed. The water level has gone down a lot (evaporation) which means that there is less carrying capacity on the ecosystem. The plant matters have almost clumped together. Although the smell is not as strong, it smells like as if there is some salt present in it (of course due to the minerals found in soil and plant matters). There is no any clear zone in the culture. The weaker smell is most likely because there are lower number of microorganisms in the eco-system. The carrying capacity has decreased and thus there are lower number of microorganisms.
The environment and the eco system that we are dealing with does not have any extremities because the pH is not high, the temperature is like that of a room temperature and salt level is normal as well. Because of the above conditions, it is very likely that Archae species will not have grown on the agar plates. Archae are mostly found in area with extremities related to pH, temperature and salt level. The table linked shows the number of bacterial colonies that are present in each of the eight plates.
One of the major differences between the plates with just nutrition agar and the plates with agar and tetracycline is the number of colonies present in the plates. The plates with just the nutrient has much larger quantity of bacterial colonies than the ones with agar and tetracycline. This shows that tetracycline causes bacteria to die. It was also noted that some of the plates with just agar had some white colonies whereas all of the plates with tetracycline had no any indication of white colonies. These white colonies are fungi. The presence of fungi in the plates with nutrient but the lack of presence of fungi in the plates with tetracycline shows that tetracycline controls the growth of fungi. Also, all the tetracycline plates had just staphylococci bacteria but the plates with agar had some rod shaped bacteria as well. Further information about the presence of such bacteria and their characterization is shown in Table 2: Bacteria Characterization below. We were not able to take pictures of the plates under microscope but the descriptions are all below.
Tetracycline bind to the 30S subunit of the bacterial ribosome. They prevent the transfer of activated amino acids to the ribosome, so protein synthesis is halted (1).It means that bacteria can not go through with the process of cell division and thus won't be able to give rise to the next generation. Once the 1st generation dies there are no more of such bacteria.
Table 2: Bacteria Characterization
All the bacterial colonies are in the picture below with the descriptions of four chosen plates in Table 2.
Conclusion: The data regarding the plates and antibiotic resistance shows that the hypothesis cannot be rejected. It is so because the plates with just nutrient had more bacterial colonies than the plates containing tetracycline and nutrient.
Reference: 1 Antibiotics: Antibacterial Agents. (2014, May 8). Retrieved February 5, 2015, from http://users.rcn.com/jkimball.ma.ultranet/BiologyPages/A/Antibiotics.html
AB
01/29/2015
Identification of Algae and Protists in the transect
Purpose: In the last experiment, we observed an environment within American University's ground and obtained sample to make a hay infusion culture. The main purpose of this particular experiment is to see all the biological lives that exist in this particular transect (Transect #5; Manicured Grassland). Using a microscope, we will be identifying protists and algae present in transect #5. We are looking where these protists and algae (near the plant materials or away from plant materials) are present.
Hypothesis: Some algae and protists are present in the Hay Infusion culture.
Materials/ Methods : The "Hay Infusion Culture" that was made in the last experiment is considered an ecosystem. The 500mls of water and vegetation mixture consists of many different types of niches. Some protists and algae prefer plant materials for food whereas some tend to be away from the plant materials. For this experiment we are looking at the protists that are present in two different niches/conditions. The ecosystem (Hay Infusion Culture) is brought to the table. With a pipette we took 2 samples altogether from 2 different niches (one from near the plant materials (top of the culture) and one from away the plant materials (middle of the culture towards the side) ). We prepared 2 microscopic slides with 2 drops of mixture in each slide and added a liquid agent that slows down the protists so that they can be observed well. Without the slowing agent, protists move very fast and are difficult to track down and observe their characteristics. Using the ocular micrometer in the microscope the size of protists were measured. Also a Dichotomous key was used to identify the protists present in the sample. The characteristics of protists were used as reference to work with dichotomous key which asked questions and gave 2 options every time thus leading to the final observation that led to identification of protists.
Procedure III: After observing the hay infusion culture we prepared serial dilutions to examine the mixture of bacterial species present in the culture. Four tubes of 10mls sterile broth are labelled with numbers 10^-2, 10^-4, 10^-6, 10^-8. We got 4 nutrient agar plate and 4 agar plus tetracycline plates. The plates were labelled accordingly with whether tetracycline was present or not and by their serial dilutions. Hay infusion culture is swirled and serial dilution is performed. After serial dilutions are made, 100 microliter of broth is placed in the agar plates and plates with tetracyclin according to their concentration with a 100 microliter pipette. The liquid is well spread on the agar side. The lids of plates are closed and will be incubated at room temperature for a week. Serial dilution and procedure explained in the image below.
Observation: As the "Hay Infusion Culture" is brought to the table, the first observation we made was the smell. The culture had a very strong smell. It almost had a rotten smell. The smell was like that of a sewer or human wasteland. The top of the culture had cell membrane like gelatinous texture up on the top. It was like the layer of fat in a boiled fatty milk. The overall appearance of the appearance was brownish. The middle part of the ecosystem is clearer than the top and the very bottom. The top of the culture had grass on the top and looked like as if they are growing on the top (they are bunched up all together). The grass bunch was green in color. The top has some dirt and wood chips present in it. The middle is almost clear but does have some grass and plant material floating towards the center of the jar. The bottom contains soil and plant matters such as leaves and chunks of wood and mulch.
The organisms/protists present nearby the plant matters and nearby just the water source are more likely to differ from each other. It is so because, the ones in just water obtain their nutrients from water because of which the way they feed is most likely to differ from the ones that feed on plants and plant materials. Water, with increase in temperature will most likely evaporate. The evaporation of water in the next two months mean that the protists that rely solely on the water for their habitat and feeding will have lower area to live. With the decrease in area to leave the carrying capacity of this particular niche will decrease thus causing the lower number of protists present solely in water. The decrease of such organisms is most likely due to the lack of food source. The following organisms are seen under the microscope from two different niches.
Protist #1 observed in Niche 1, nearby plant matters is Paramecium Aurelia. When observed under 10x magnification under the ocular microscope, it was 12 ocular spaces large which translates to 120 micrometer in length. It is ciliated and moved relatively fast when compared to other organisms. Also, its general characteristic for its color is clear/white. Protist.
Protist #2 observed in this Niche 1, nearby plant matters is Colpidium, which when observed under 40x magnification is 20 ocular spaces large. The size translates to 50 micrometer in length. It is oval in shape and is consistent with clear color. Compared to Paramecium, the movement is rather stagnant and very random with no relative pattern. Protist
Protist #3 observed in this Niche 1, nearby plant matters is "unknow". Even with the dichotomous key this was rather unidentifiable. Its characteristics are that it changes shape from round to being oval time and again. There are a lot of organelles like structures inside the cell. It is 25 ocular spaces at 40x magnification. It is ciliated and there is no any distinct motion and moves around circle as it changes shape. Protist.
Protist #1 observed in this Niche 2, away from plant matters is Colpidium, which when observed under 40x magnification is 20 ocular spaces large. The size translates to 50 micrometer in length. It is oval in shape and is consistent with clear color. Compared to Paramecium, the movement is rather stagnant and very random with no relative pattern. Protist
Protist #2 observed in this Niche 2, away from plant matters is a Chlamydomonas. It is green in color (can photosynthesize). At 40x magnification it is 6 ocular spaces in size and translates to 15 micrometer in length. Its general characteristic is the presence of 2 flagellum and single celled. It is a kind of algae and can photosynthesize. It is motile.
Protist #3 observed in this Niche 2, away from plant matters is Gonium. It was very easy to distinguish because of the colonial shape it was in. Greenish in color, the colony was about 20 ocular spaces in size and round. The 20 ocular spaces at 40x translates to 50 micrometer in length. It is a kind of algae and can photosynthesize. They move as a group.
Conclusion: It can be concluded that the transect #5 do have a lot of organisms. Because we were able to see some organisms (protists and algae) it helps to the support the hypothesis that the hay transfusion culture has some protists and algae which ultimately leads to conclude that there are protists and algae present in the transect #5.
AB
01/25/2015
Observing a Niche at American University and seeing the biological lives that live in certain American University Niche
Purpose: The main purpose of this experiment is to observe a certain environment within American University and see all the biological lives that exist in this community. This experiment also goes along with looking at the dependence of certain living organisms as small as bacteria, protists to insects, bugs and squirrels. We are also looking at how certain disturbances such as human interactions and natural disasters are responsible for some changes in the niche.
Hypothesis: There is a great diversity of protists and bacteria in this transect.
Prediction: If there are protists and bacteria present in this transect, the hay infusion culture followed by observing the sample of the culture under microscope should show presence of protists and bacteria.
Materials/ Methods: A 20 X 20 transect is marked with popsicle sticks. There are 5 transects with in American University. The transects vary on their characterization. There are transects which is manicured grassland and other which is a marshland and three others. Our group was assigned with the manicured grassland. As the transects were also labeled with number, the transect that we were assigned is transect #5. This particular experiment required us to do nothing more than inspect and observe the niche we were assigned to. We identified our niche and started looking at everything present within the 20 X 20 transect. We also collected sample of everything that was in the transect. The sample we collected was a mini version of the transect itself. A sterile 50ml conical tube is used to obtain the sample. Other materials that were needed to conduct this experiment were popsicle sticks (four) and the transect itself.
The observation of the transect and collection of the sample of the transect was followed by a Hay Infusion Culture. For the Hay Infusion culture we used 10 to 12 grams of the vegetation we collected in the 50ml conical tube and mixed it together with 500mls of deerpark water in a jar. To the mixture of vegetation and water, 0.1 grams of dried milt was added. We gently mixed the mixture of those substances for 10 seconds and the jar was stored with its top off.
Data/ Observation: The location of this transect is around the Eric A Friedham Quadrangle seating area in the main quad of American University. The transect is looking at Batelle with back towards Hurst building. To the right of transect is Kay Spiritual Center. The transect includes a small part of the seating area itself. When looking at Batelle with back towards Hurst, the transect is to the right of the middle of the seating area that is lead by a path. The transect is to the right. The transect incorporates dead bushes and shrubs with wilted leaves lying on the grassy manicured land. The shrubs are growing on the mulch which is one of the features of the transect itself. The mulch area looks fertile and promises a lot of microbes and bacteria.There are two different kinds of bushes.
The biotic (living) factors of the transect are as follows: 1: Grass (Manicured grassland) 2: Shrubs/Bushes : There are two kinds of shrubs and one kind is prickly as it is covered with thorns all along its stem. 3: Leaves : (More likely that they fell down from tree that is nearby 'the tree does not fall inside the transect assigned'. The leaves are all wilted) 4: Squirrels : (Not there at the time of observation because it is winter now but I have seen many squirrels running around in that area during fall) 5: Insects / Bugs
There are some abiotic factors in the transect and they are as follows: 1: Mulch (There are some wood pellets.) 2: Soil (The soil looks fertile and promises home for some of the living organisms and a good source of nutrients for the shrubs planted in it) 3: Snow and water (Being winter, there is some snow on the ground) 4: Stone benches (act as one of the possible disturbance to the natural environment of the transect) 5: Air (Air is everywhere, but it also includes air coming from the human breath from the people who walk along the area going to and fro classes and of those who sit on the benches for getting some fresh air)
Some other features of the transect are the already built seating area. There was also some wastes lying on the area of transect. There was a fork lying down on the ground. Not only that, there were some human footsteps/ prints which means that people and other animals are walking by it. It promises for disturbances caused by the interaction of human to the environment.
Conclusion: Looking at the biotic factors such as leaves and bushes along with abiotic factors such as mulch, soil and air it can be concluded that there are a lot of living microbes such as protists and bacteria in this transect.
AB
01/21/2015
Can't wait to dissect rats.
AB













