User:Dorothy Spingarn/Notebook/Biology 210 at AU: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
 
(11 intermediate revisions by the same user not shown)
Line 1: Line 1:
'''Zebrafish Lab'''
https://docs.google.com/spreadsheets/d/1A057-rdsJsA2jk40-YJgsTcND3CSJEktjaeWMa0cYq8/edit#gid=0
'''March 3, 2016'''
'''16S Sequence Analysis'''
'''Purpose'''
The purpose of this was to use the DNA from the PCR and the gel electrophoresis to determine the actual bacteria present. This allows for an understanding that dichotomous keys, while helpful, are not the be-all-end-all of determining a species.
'''Materials and Methods'''
After performing the PCR and the gel electrophoresis, the working specimens were sent off to be analyzed. Bacteria from transect 4 was analysed and returned along with an ID number for a sequence. This sequence :
NNNNNNNNNNNNNGNNANNCNTGCAGTCGAGCGGTAGTCACNNNNAGCTTGCTCTCGGGTGACGAGCGGCGGACGGGTGA
GTAATGTCTGGGAAACTNGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCA
AAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAG
GCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC
AGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTA
CTTTCAGCGAGGAGGAAGGCATTGTGGTTAATAACCACAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCG
TGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCA
AGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGA
ATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACG
CTCANNTGCGAAAGCGTGGGGAGCAAACAGGNANNAGATACCCTGGTAGTCCACGCCGTNNCGATGTCGACTTGGAGGTT
GTTCCCTTGAGGAGTGGCTTCCGGAGCTAACGCGTTAANTCGACCGCCTGGGGANTACGGCCGCANNGTTAAAACTCAGA
TGAATTGACNGGGGNNCGCACAANCGGTGGNGCNNGTGGTTTAATTCGATGCAACGCGAANNANCCNTNACCTACTCTTG
ACATCCNNANAACTTAGCNNNGATNCTTTNGTGCCTTCNNNAACTNNNNNNCAGGTGCTGCNNGGCTNTCGTCNNNCNTG
NN
was entered into an NCBI database and then analyzed further to determine what species it could possibly be.
'''Data'''
The bacteria was 93% similar to enterobacter bacteria, a gram negative bacteria. 
'''Conclusion'''
This data in consistent with the information that was found in the transect. We determined that all of the bacteria was gram-negative, and the information that the bacteria found was gram-negative proves this.
*'''[[User:Dorothy Spingarn|Dorothy Spingarn]] 23:00, 3 March 2016 (EST)''':DLS
'''February 26, 2016'''
'''Invertebrates'''
'''Purpose'''
The purpose of this lab was to introduce the possible invertebrates that may live in the transect. By seeing a variety of invertebrates in the transect, it becomes possible to learn about different type of motility and germ tissues. By learning about acoelomates, pseudocoelomates, and coelomates, it becomes possible to understand different types of symmetry.
'''Materials and Methods'''
When setting up a Berlese funnel, use 25 mL of the 50:50 water/ethanol solution in a conical tube. Place screening material into the funnel to ensure that large pieces of leaves do not fall into the conical tube. Place as much leaf litter as possible into the funnel, and place the funnel into the conical tube, making sure that the bottom of the funnel doesn't touch the ethanol/water solution. Attach the two using parafilm and tape and place the funnel/conical tube under a 40 watt bulb and cover  everything with foil. Pour the top 10-15 mL of the water/ethanol mixture into one petri dish and pour the reamining liquid into a second petri dish. Using a dissection microscope, observe the petri dishes. Try to find five invertebrates in the dishes.
'''Data'''
      Organism            Length            Number in Sample            Description
1:    Arthropoda            3x                                1                              fly- wings and antennae
2:  Arthropoda            3x                                1                            lice thing- mallophaga
3:  Arthropoda            3x                                1                              flea- siphonaptera
'''Conclusions'''
Unfortunately the Berlese funnel only produced three invertebrates, all of which were arthropoda. However, this may be representative of the type of invertebrates that live in the transect. Because of the time of year, it is very possible that the lack of invertebrates was caused by the temperature. Two of the three invertebrates that were found were in the first pertri dish containing the water from the top 10-15 showing that the dead invertebrates float and that they are likely to be found at the bottom of a collection of leaf litter.
'''February 19, 2016'''
'''Plants and Fungi'''
'''Purpose'''
The purpose of this lab was to present a new group of organisms that drive much of life on the planet. Plants create the majority of oxygen on the planet and fungi fill the ever important decomposer niche. The main type of plants that are to be looked at during this lab are angiosperms, flowering plants, where are there are several forms of fungi: zygomycota- saprophytic and terrestrial, basidiomycota- typically mushrooms, and ascomycota- a large group of mostly pathenogenic organisms.By doing this, the students get acquainted with the vast amount of plants and fungi as well as the alternation of generations in bryophytes and angiosperms.
'''Materials and Methods'''
Using the plants collected from the transect, observe five unique plants or fungi and observe their features, record this and determine the type of plant/fungi that they are. Looking at the prepared lily and moss slides, practice determining features on plants. After practicing with a lily, use this knowledge to determine whether the five plants/fungi samples are dicot (a pair) or monocot (single) based on the petals or leaves collected. When setting up a Berlese funnel, use 25 mL of the 50:50 water/ethanol solution in a conical tube. Place screening material into the funnel to ensure that large pieces of leaves do not fall into the conical tube. Place as much leaf litter as possible into the funnel, and place the funnel into the conical tube, making sure that the bottom of the funnel doesn't touch the ethanol/water solution. Attach the two using parafilm and tape and place the funnel/conical tube under a 40 watt bulb and cover  everything with foil. 
'''Data'''
The five plants chosen was a 4'x4' flower bush in the back right corner of the transect, foot high dead grasses in the middle of the transect next to the pond, one inch tall green grass near the front of the transect, a branchy 2'x3' bush (using the leaves from the bush) from the front left corner of the transect, and three inch green shoots from the middle of the transect.
[[Image:5samplesfromtransectdls.jpg|center|480x240px|alt=samples|Samples from Transect 4]]
All of the samples seemed to have stomata because none of them were fungi, however sample two was difficult to see because the sample was dead due to the time of year.
The flowering bush (#1) is a dicot angiosperm because of the structure of the leaf, it has both stomata on the leaves and flowers on the bush, the the bush uses seeds to reproduce.
The long grass (#2) is a monocot angiosperm because of the structure of the leaf, we assume it has stomata because it is a leaf however because the grasses were dead, it is hard to tell, and the grasses reproduce by seeds and pollen.
The short grass (#3) is a monocot angiosperm because of the structure of the leaf, because of the size of the leaf, it is difficult to tell if there are stomata, however, because it is a leaf, we can assume that there are stomata.
The branchy bush (#4)  is a dicot angiosperm because of the leaf structure and reproduces using seeds.
The green shoots (#5) is a monocot angiosperm because of the leaf structure and used bulbs as reproducing mechanisms.
'''Conclusion'''
Using this information we can assume that the majority of the plants/fungi in transect four are angiosperms. There seemed to be a lack of fungi in the transect. The angiosperms use the stomata to stay alive year round.
*'''[[User:Dorothy Spingarn|Dorothy Spingarn]] 19:43, 18 February 2016 (EST)''':DLS
'''February 12, 2016'''
'''Microbiology'''
'''Purpose'''
The purpose of this lad was to introduce students to the microbiology of their transects and the protocol of PCRs. By doing this, the students gained the knowledge of how to set up a PCR and the vast array of microbes that were in the transects. Along with setting up a PCR, this lab focused on gram stains and if the agar plates were gram negative or gram positive.
'''Materials and Methods'''
Take note of of the lawn that has formed on the agar plates, noting the number of colonies on each plate (see the serial dilution table). Following the determination of whether or not bacteria was affected by the addition of tetrocycline, wet mounts and gram stains were created using four of the agar plates. Group four chose plates 10(-3), 10(-5), 10(-7), and tet 10(-3). After this, create a PCR for two of the agar plates, group four chose to do the PCR with agar plate 10(-5) without tet and plate 10(-3) with tet. The PCR has been set to determine the presence of the 16S rRNA gene.
'''Data'''
At the end of using the hay infusions, the specific hay infusion for transect 4 had retained its film on the top, but the film had gotten more opaque and slightly thicker. The smell of the hay infusion had remained the same, a very swampy smell. 
[[Image:Serialdilutiontabledls.jpg|thumb|left|480x240px|alt=serial dilution table|Serial Dilutions Table]]
[[Image:Bacteriacharacterizationdls.jpg|thumb|right|480x240px|alt=bacterial characterizations|Bacteria Characteriaztions]]
The colonies that formed on the agar plates with the antibiotic had far less bacterial growth compared to the plates without the antibiotics. This means that Tetracycline is successful in inhibiting the growth and development of bacterial and fungi. The gram stains turned out to all be gram negative.
'''Conclusion'''
Because all of the gram stains were gram negative, it can be determined that the bacteria had less peptidoglycan in their cell walls, making them susceptible to tetracycline. Only the bacteria from plates 10(-5) and 10(-7) were mobile, and were very mobile.
'''February 5, 2016'''
'''February 5, 2016'''
'''Exercise 2: Identifying Algae and Protists'''
'''Exercise 2: Identifying Algae and Protists'''

Latest revision as of 16:30, 13 March 2016

Zebrafish Lab https://docs.google.com/spreadsheets/d/1A057-rdsJsA2jk40-YJgsTcND3CSJEktjaeWMa0cYq8/edit#gid=0

March 3, 2016 16S Sequence Analysis

Purpose The purpose of this was to use the DNA from the PCR and the gel electrophoresis to determine the actual bacteria present. This allows for an understanding that dichotomous keys, while helpful, are not the be-all-end-all of determining a species.

Materials and Methods After performing the PCR and the gel electrophoresis, the working specimens were sent off to be analyzed. Bacteria from transect 4 was analysed and returned along with an ID number for a sequence. This sequence :

NNNNNNNNNNNNNGNNANNCNTGCAGTCGAGCGGTAGTCACNNNNAGCTTGCTCTCGGGTGACGAGCGGCGGACGGGTGA GTAATGTCTGGGAAACTNGCCTGATGGAGGGGGATAACTACTGGAAACGGTAGCTAATACCGCATAACGTCGCAAGACCA AAGAGGGGGACCTTCGGGCCTCTTGCCATCAGATGTGCCCAGATGGGATTAGCTAGTAGGTGGGGTAATGGCTCACCTAG GCGACGATCCCTAGCTGGTCTGAGAGGATGACCAGCCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC AGTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTA CTTTCAGCGAGGAGGAAGGCATTGTGGTTAATAACCACAGTGATTGACGTTACTCGCAGAAGAAGCACCGGCTAACTCCG TGCCAGCAGCCGCGGTAATACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCA AGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGA ATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGGTGGCGAAGGCGGCCCCCTGGACAAAGACTGACG CTCANNTGCGAAAGCGTGGGGAGCAAACAGGNANNAGATACCCTGGTAGTCCACGCCGTNNCGATGTCGACTTGGAGGTT GTTCCCTTGAGGAGTGGCTTCCGGAGCTAACGCGTTAANTCGACCGCCTGGGGANTACGGCCGCANNGTTAAAACTCAGA TGAATTGACNGGGGNNCGCACAANCGGTGGNGCNNGTGGTTTAATTCGATGCAACGCGAANNANCCNTNACCTACTCTTG ACATCCNNANAACTTAGCNNNGATNCTTTNGTGCCTTCNNNAACTNNNNNNCAGGTGCTGCNNGGCTNTCGTCNNNCNTG NN

was entered into an NCBI database and then analyzed further to determine what species it could possibly be.

Data The bacteria was 93% similar to enterobacter bacteria, a gram negative bacteria.

Conclusion This data in consistent with the information that was found in the transect. We determined that all of the bacteria was gram-negative, and the information that the bacteria found was gram-negative proves this.


February 26, 2016 Invertebrates

Purpose The purpose of this lab was to introduce the possible invertebrates that may live in the transect. By seeing a variety of invertebrates in the transect, it becomes possible to learn about different type of motility and germ tissues. By learning about acoelomates, pseudocoelomates, and coelomates, it becomes possible to understand different types of symmetry.

Materials and Methods When setting up a Berlese funnel, use 25 mL of the 50:50 water/ethanol solution in a conical tube. Place screening material into the funnel to ensure that large pieces of leaves do not fall into the conical tube. Place as much leaf litter as possible into the funnel, and place the funnel into the conical tube, making sure that the bottom of the funnel doesn't touch the ethanol/water solution. Attach the two using parafilm and tape and place the funnel/conical tube under a 40 watt bulb and cover everything with foil. Pour the top 10-15 mL of the water/ethanol mixture into one petri dish and pour the reamining liquid into a second petri dish. Using a dissection microscope, observe the petri dishes. Try to find five invertebrates in the dishes.

Data

      Organism            Length            Number in Sample            Description

1: Arthropoda 3x 1 fly- wings and antennae 2: Arthropoda 3x 1 lice thing- mallophaga 3: Arthropoda 3x 1 flea- siphonaptera

Conclusions Unfortunately the Berlese funnel only produced three invertebrates, all of which were arthropoda. However, this may be representative of the type of invertebrates that live in the transect. Because of the time of year, it is very possible that the lack of invertebrates was caused by the temperature. Two of the three invertebrates that were found were in the first pertri dish containing the water from the top 10-15 showing that the dead invertebrates float and that they are likely to be found at the bottom of a collection of leaf litter.


February 19, 2016 Plants and Fungi

Purpose The purpose of this lab was to present a new group of organisms that drive much of life on the planet. Plants create the majority of oxygen on the planet and fungi fill the ever important decomposer niche. The main type of plants that are to be looked at during this lab are angiosperms, flowering plants, where are there are several forms of fungi: zygomycota- saprophytic and terrestrial, basidiomycota- typically mushrooms, and ascomycota- a large group of mostly pathenogenic organisms.By doing this, the students get acquainted with the vast amount of plants and fungi as well as the alternation of generations in bryophytes and angiosperms.

Materials and Methods Using the plants collected from the transect, observe five unique plants or fungi and observe their features, record this and determine the type of plant/fungi that they are. Looking at the prepared lily and moss slides, practice determining features on plants. After practicing with a lily, use this knowledge to determine whether the five plants/fungi samples are dicot (a pair) or monocot (single) based on the petals or leaves collected. When setting up a Berlese funnel, use 25 mL of the 50:50 water/ethanol solution in a conical tube. Place screening material into the funnel to ensure that large pieces of leaves do not fall into the conical tube. Place as much leaf litter as possible into the funnel, and place the funnel into the conical tube, making sure that the bottom of the funnel doesn't touch the ethanol/water solution. Attach the two using parafilm and tape and place the funnel/conical tube under a 40 watt bulb and cover everything with foil.

Data The five plants chosen was a 4'x4' flower bush in the back right corner of the transect, foot high dead grasses in the middle of the transect next to the pond, one inch tall green grass near the front of the transect, a branchy 2'x3' bush (using the leaves from the bush) from the front left corner of the transect, and three inch green shoots from the middle of the transect.

samples
Samples from Transect 4

All of the samples seemed to have stomata because none of them were fungi, however sample two was difficult to see because the sample was dead due to the time of year.

The flowering bush (#1) is a dicot angiosperm because of the structure of the leaf, it has both stomata on the leaves and flowers on the bush, the the bush uses seeds to reproduce. The long grass (#2) is a monocot angiosperm because of the structure of the leaf, we assume it has stomata because it is a leaf however because the grasses were dead, it is hard to tell, and the grasses reproduce by seeds and pollen. The short grass (#3) is a monocot angiosperm because of the structure of the leaf, because of the size of the leaf, it is difficult to tell if there are stomata, however, because it is a leaf, we can assume that there are stomata. The branchy bush (#4) is a dicot angiosperm because of the leaf structure and reproduces using seeds. The green shoots (#5) is a monocot angiosperm because of the leaf structure and used bulbs as reproducing mechanisms.

Conclusion Using this information we can assume that the majority of the plants/fungi in transect four are angiosperms. There seemed to be a lack of fungi in the transect. The angiosperms use the stomata to stay alive year round.


February 12, 2016 Microbiology

Purpose The purpose of this lad was to introduce students to the microbiology of their transects and the protocol of PCRs. By doing this, the students gained the knowledge of how to set up a PCR and the vast array of microbes that were in the transects. Along with setting up a PCR, this lab focused on gram stains and if the agar plates were gram negative or gram positive.

Materials and Methods Take note of of the lawn that has formed on the agar plates, noting the number of colonies on each plate (see the serial dilution table). Following the determination of whether or not bacteria was affected by the addition of tetrocycline, wet mounts and gram stains were created using four of the agar plates. Group four chose plates 10(-3), 10(-5), 10(-7), and tet 10(-3). After this, create a PCR for two of the agar plates, group four chose to do the PCR with agar plate 10(-5) without tet and plate 10(-3) with tet. The PCR has been set to determine the presence of the 16S rRNA gene.

Data At the end of using the hay infusions, the specific hay infusion for transect 4 had retained its film on the top, but the film had gotten more opaque and slightly thicker. The smell of the hay infusion had remained the same, a very swampy smell.

serial dilution table
Serial Dilutions Table
bacterial characterizations
Bacteria Characteriaztions

The colonies that formed on the agar plates with the antibiotic had far less bacterial growth compared to the plates without the antibiotics. This means that Tetracycline is successful in inhibiting the growth and development of bacterial and fungi. The gram stains turned out to all be gram negative.

Conclusion Because all of the gram stains were gram negative, it can be determined that the bacteria had less peptidoglycan in their cell walls, making them susceptible to tetracycline. Only the bacteria from plates 10(-5) and 10(-7) were mobile, and were very mobile.


February 5, 2016 Exercise 2: Identifying Algae and Protists

Purpose The purpose of this lab was to introduce the students to a dichotomous key and learn how to use one properly. This was in order to be able to properly idetify the organisms found in the hay infusion for each transect. Because the environment is different at the top, middle, and bottom of the hay infusion, in each section, different organisms will be found.

Materials and Methods The lab was comprised of three procedures, with procedure one being practice for procedure two. During procedure one, the students looked at wet mounts and immobile specimens in order to get used to using a dichotomous key before going onto the moving organisms in the transects. Procedure two involved splitting up the hay infusions into three sections, top, middle, and bottom, and observing the organisms at each section. Using the dichotomous key, the goal was to determine some of the organisms found. Procedure three was preparing for the following lab by setting up agar plates.

Data

drawings of protists
data from the wet mounts

During this, the hay infusion smelled very strongly of a swamp, with a sulfuric smell similar to rotten eggs, as well as having some sort of film over the top of the water. Based on the dichotomous key, there seemed to be various kinds of algae and protists in the hay infusion, including stentor, gloeocspa, and possible haematococcus. Stentor measured to be about 10 micrometers, with random, quick movements, characterized by a compressing motion as it moved, similar to a slinky. Gloeocspa meatured to be about 5 micrometers and was found in colonies and looked like a dart board, with a defined inner and outer ring.

drawing of serial dilution
serial dilution

The serial dilutions were for the following week's lab in order to compare the affect the agar plates had on different concentrations of bacteria.

Conclusion This experiment showed that there are different organisms in different layers of a hay infusion. In comparing this to the real world, it shows that there are different bacteria in different layers of natural water features and that there are different bacteria found in different areas of the transect and therefore different section of dirt.


January 15, 2016 Exercise 1: Examining Biological Life at AU

Purpose The purpose of this lab was to introduce the class to various microscopic life and to introduce the class to the various transects. This prepares us for future experiments in this part of the lab. The microscopic life visible in the first part of the lab, the Chlamydomonas, Gonium, and Volvox, will probably be visible in the transect samples.

Materials and Methods Procedure one consisted of setting up the microscopes to look at the samples of Chlamydomonas, Gonium, and Volvox and making observations on the size, colony size, and specialization of the cells. Abiotic components included rocks, tree, and soil. Biotic components included fish. Procedure two involved going to the transect, getting samples from water features and soil samples, as well as documenting the landscape with picture and drawings. Observe the 20 by 20 foot dimensions of the transect marked by popsicle sticks. Procedure three was the creation of a hay sample by taking 10 to 12 grams of the soil/ground sample and mixing it with 500 mL of Deerpark water. Add 0.1 grams of dried milk to the water and soil mixture and mix. Let the jar sit.

Image of Aerial View of Transect:

Data Images of Transect 4:

Images of Hay Infusion:

Conclusion The hay infusion will be examined at a later time, however, assuming that similar organisms are found, the hypothesis will be supported.