BME100 s2017:Group8 W8AM L4: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
Line 17: Line 17:
| [[Image:Meghan2.jpg|100px|thumb|Name: Meghan Rasmussen]]
| [[Image:Meghan2.jpg|100px|thumb|Name: Meghan Rasmussen]]
| [[Image:Salma.jpg|100px|thumb|Name: Salma Leyasi<br>Role(s)]]
| [[Image:Salma.jpg|100px|thumb|Name: Salma Leyasi<br>Role(s)]]
| [[Image:BME103student.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:NickC8.jpg|100px|thumb|Name: Nicholas Chung]]
| [[Image:BME103student.jpg|100px|thumb|Name: student<br>Role(s)]]
| [[Image:NickS8.jpg|100px|thumb|Name: Nicholas Sora]]
|}
|}



Latest revision as of 07:15, 22 March 2017

BME 100 Spring 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Michelle Loui
Name: Ezekiel Mendoza
Name: Meghan Rasmussen
Name: Salma Leyasi
Role(s)
Name: Nicholas Chung
Name: Nicholas Sora

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 microLiters each: mix contains Taq DNA polymerase, MgCl2, and dNTP's
  • DNA/primer mix, 8 tubes, 50 microLiters each: each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G8 + Positive control none
G8 - Negative control none
G8 1-1 Patient 1, replicate 1 19974-1
G8 1-2 Patient 1, replicate 2 19974-2
G8 1-3 Patient 1, replicate 3 19974-3
G8 2-1 Patient 2, replicate 1 17269-1
G8 2-2 Patient 2, replicate 2 17269-2
G# 2-3 Patient 2, replicate 3 17269-3


DNA Sample Set-up Procedure

  1. Step 1: Extract desired DNA from target cells
  2. Step 2: Move extracted DNA into a special PCR tube for even heat distribution
  3. Step 3: Add Primer 1 to PCR tube
  4. Step 4: Add Primer 2 to the second site
  5. Step 5: Add nucleotides the PCR tube
  6. Step 6: Add Taq DNA polymerase to PCR tube
  7. Step 7: Place PCR tube with all reaction components in a DNA Thermal Cycler

OpenPCR program

HEATED LID: 100°C
INITIAL STEP: 95°C for 2 minutes
NUMBER OF CYCLES: 25
Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and Extend at 72°C for 30 seconds
FINAL STEP: 72°C for 2 minutes
FINAL HOLD: 4°C






Research and Development

PCR - The Underlying Technology

What is the function of each component of a PCR reaction?
Template DNA: When the DNA double helix unwinds during the denaturing process of a PCR reaction, the two individual strands are called template DNA. Each individual strand acts as a template for its pair. So when primers attach to one strand, DNA polymerase makes the matching second strand of DNA by attaching complimentary nucleotides.
Primers: Primers attach to complimentary ends of the separated DNA strands. Primers allow DNA polymerase to attach to the DNA strand. Without primers, DNA polymerase couldn't attach to the DNA strand. Primers can be designed to attach to any specific nucleotide sequence desired.
DNA Polymerase: DNA polymerase is an enzyme that attaches to both strands of DNA after the helix separates during the denaturing process. Once attached to the primer on the DNA strand, DNA polymerase begins grabbing nucleotides out of the solution and attaches the complimentary nucleotide to the one in the DNA strand (A to T, C to G).
Deoxyribonucleotides: Deoxyribonucleotides are the building blocks of DNA (A,C,T,G). In a PCR reaction, DNA polymerase takes the nucleotides that are floating in the solution and attaches them to the template DNA starting at the primer, replicating the matching DNA strand in the process.

What happens to the components listed above during each step of thermal cycling?
Initial Step (95 degrees C for 3 minutes): During the initial step, the OpenPCR machine and solution are beginning the first cycle of denaturing.
Denature (95 degrees C for 30 seconds): During this step, the DNA double helix is untwisted and separated into two single strands of DNA.
Anneal (57 degrees C for 30 seconds): As the temperature cools down, the primers attach to the single strands of DNA. Since the DNA strands naturally want to join back together, the primers forbid that from happening.
Extend (72 degrees C for 30 seconds): In this stage, DNA polymerase attaches to the primers and begins attaching complimentary nucleotides to the single strand, creating a complimentary single strand.
Final Step (72 degrees C for 3 minutes): The final step allows for the DNA polymerase to finish completing any partial copies and gives the primers and DNA polymerase a chance to detach from the strands.
Final Hold: Once the PCR reaction is complete, the thermal cycler is set to 4 degrees Celcius to maintain the integrity of the replicated DNA until the tubes can be removed from the OpenPCR machine.

Which base anneals to each base listed below?
Adenine (A) pairs up with Thymine (T)
Cytosine (C) pairs up with Guanine (G)

During which two steps of thermal cycling does base-pairing occur?
Base-pairing occurs during the Extend step and the Final Step of thermal cycling. During the extend step is when DNA polymerase attaches to the primers on the single strands of DNA and begins attaching matching pairs of nucleotides together. The final step is when DNA polymerase continues its job by finishing any partially completed copies and cleans up the replicated copies.



SNP Information & Primer Design

Background: About the Disease SNP
Nucleotides are the building blocks of DNA (deoxyribonucleic acid). Nucleotide Polymorphism is a condition when there is a variation in DNA among species members. The SNP mutation is found in Homo Sapian in the 7:117587799 chromosome. It is linked to the pathogenic disease, cystic fibrosis. This mutation is one of the few linked to cystic fibrosis.


Primer Design and Testing CFTR stands for Cystic Fibrosis Transmembrane Conductance Regulator. The CFTR functions as a channel across different membranes, helping the sodium-potassium pump work and maintaining the correct charge in a cell. The sodium-potassium pump and CFTR are essential for cell and organ function. An allele is an alternative form of a gene. In the case of CFTR, the disease allele is CGT and its position is 117587799.

Regarding CFTR, the non-disease forward and reverse primers are AGAAGGTGGAATCACATGA and CATTATTTATAGTTCTTAAAT, respectively. The non-disease primers are the primers found in normal, healthy CFTR genes and alleles. The disease forward and reverse primers are AGAAGGTGGAATCACACTGC and CATTATTTATAGTTCTTAAAT, respectively. The disease primers are the primers found in malfunctioning CFTR genes. The type of SNP found in CFTR primers affects the transport pathway through the semipermeable membrane of cells. Mutations in this primer codon cause autoimmune disorders such as cystic fibrosis and congenital bilateral aplasia of the vas deferens. This mutation can also lead to scarring of organ tissues because of the increased mucus production in the body.

Results for Non-Disease Primer:

Results for Disease Primer:

Sources

"PCR Virtual Lab" http://learn.genetics.utah.edu/content/labs/pcr/