BME100 s2017:Group1 W8AM L4

From OpenWetWare
Revision as of 05:37, 22 March 2017 by Emily A. Steeley (talk | contribs) (Research and Development)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to navigationJump to search
BME 100 Spring 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help


THAT BME GROUP

Name: Paulina Gomez
Name: Emily Steeley
Name: Arlette Geller
Name: Hang Zheng
Name: Shane Jones
Name: John Dell'Angelo

LAB 4 WRITE-UP

Protocol

Materials

  1. Lab coat and disposable gloves
  2. PCR reaction mix, 8 tubes, 50 µL each
  3. DNA/ primer mix, 8 tubes, 50 µL each
  4. A strip of empty PCR tubes
  5. Disposable pipette tips
  6. Cup for discarded tips
  7. Micropipettor
  8. OpenPCR machine


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G1 + Positive control none
G1 - Negative control none
G1 1-1 Patient 1, replicate 1 95052
G1 1-2 Patient 1, replicate 2 95052
G1 1-3 Patient 1, replicate 3 95052
G1 2-1 Patient 2, replicate 1 38404
G1 2-2 Patient 2, replicate 2 38404
G1 2-3 Patient 2, replicate 3 38404


DNA Sample Set-up Procedure

  1. Step 1: Add the extracted DNA to the PCR tube
  2. Step 2: Add primer 1 to the PCR tube
  3. Step 3: Add primer 2 to the PCR tube
  4. Step 4: Add nucleotide to the PCR tube
  5. Step 5: Add DNA polymerase to the PCR tube
  6. Step 6: placing the tubes into the thermal cycler


OpenPCR program

  1. HEATED LID: 100°C
  2. INITIAL STEP: 95°C for 2 minutes
  3. NUMBER OF CYCLES: 25
  4. Denature at 95°C for 30 seconds, Anneal at 57°C for 30 seconds, and
  5. Extend at 72°C for 30 seconds
  6. FINAL STEP: 72°C for 2 minutes
  7. FINAL HOLD: 4°C



Research and Development

PCR - The Underlying Technology

What is the function of each component of a PCR reaction?

Template DNA Template DNA is the particular DNA sequence to be replicated.
Primers Primers are short pieces of DNA that are made in a laboratory.
Taq Polymerase The DNA polymerase that's most often used in PCR comes from a strain of bacteria called Thermus aquaticus. It is a naturally occurring complex of proteins whose function is to copy a cell's DNA before it divides in two.
Deoxyribonucleotides(dNTP’s) Adenine, guanine, cytosine and thymine are the building blocks that DNA molecules are made of, and are responsible for the coding of specific genes.


What happens to the components (listed above) during each step of thermal cycling?
Initial step (95°C for 3 minutes): It makes DNA double helix separates and activate the hot start polymerase.
Denature​ (95°C for 30 seconds): The template DNA double helix separates,creating two single-stranded DNA molecules.
Anneal​ (57°C for 30 seconds): Primers pair lock onto their target.
Extend​ (72°C for 30 seconds): DNA polymerase is activated, and will match complementary nucleotides onto the strand.
Final step (72°C for 3 minutes): All products promote to complete synthesis.
Final hold (4°C): DNA molecules are preserved.


DNA is made up of four types of molecules called nucleotides, designated as A, T, C and G. Base-pairing, driven by hydrogen bonding, allows base pairs to stick together. Which base anneals to each base listed below?
Adenine (A): Thymine (T)
Thymine (T): Adenine (A)
Cytosine (C): Guanine (G)
Guanine (G): Cytosine (C)


During which two steps of thermal cycling does base-pairing occur?
Annealing and Extending are the two steps of the thermal cycling in which the base-pairing occurs. In the annealing step, when the temperature drops, the DNA is separated in two strand which allows the primers to attach to it. After, in the extending step, the temperature goes up to 72 degrees which allows the DNA polymerase to pair the correct bases to the DNA strand.

SNP Information & Primer Design

Background: About the Disease SNP
An SNP is a variation of a phenotype found in homo sapiens. SNPs are located in the chromosome 7:117587799. Cardiac failure, as well as cystic fibrosis can be linked to SNPs. The affected allele contains the codon CGT. A non-diseased forward primer is as follows

  • 5’ AGAAGGTGGAATCACACTGA 3’

The disease forward primer changes the last letter of that primer, resulting in

  • 5’ CATTATTTATAGTTCTTAAA 3’.

Primer Design and Testing
The primer test was performed by finding the nucleotide containing the CTFR variation of the primer, modifying it, and entering into the database containing other primers. The non-diseased primer had a match, since it is in the database. There was no match for the diseased primer.