BME100 s2017:Group2 W1030AM L4: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Anh Nguyen (talk | contribs)
Anh Nguyen (talk | contribs)
 
(9 intermediate revisions by the same user not shown)
Line 10: Line 10:


=OUR TEAM=
=OUR TEAM=
[[Image:pug.jpg]]
{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|- valign="top"
|- valign="top"
| [[Image:BME103student.jpg|100px|thumb|Name: Anh Nguyen]]
| [[Image:giraffe.jpg|100px|thumb|Name: Anh Nguyen]]
| [[Image:BME103student.jpg|100px|thumb|Name: Sheridan Hill]]
| [[Image:dolphins.jpg|100px|thumb|Name: Sheridan Hill]]
| [[Image:BME103student.jpg|100px|thumb|Name: Derall Riley]]
| [[Image:jellyfishes.jpg|100px|thumb|Name: Derall Riley]]
| [[Image:BME103student.jpg|100px|thumb|Name: Kiryl Sheleg]]
| [[Image:Porcupine ZN.jpg|100px|thumb|Name: Kiryl Sheleg]]
| [[Image:BME103student.jpg|100px|thumb|Name: Thomas Andrews]]
| [[Image:Mooooose.jpg|100px|thumb|Name: Thomas Andrews]]
| [[Image:BME103student.jpg|100px|thumb|Name: Skye Russell]]
| [[Image:pugs.jpg|100px|thumb|Name: Skye Russell]]
|}
|}


Line 66: Line 65:


'''DNA Sample Set-up Procedure'''
'''DNA Sample Set-up Procedure'''
 
# Label empty tubes with the information from the above table.
# Move the DNA we are working with to the PCR tube
# Place 50 µL of the PCR reaction mix into the "positive control" tube. Don't forget to use a new pipette tip to avoid cross-contamination.
# Add the first primer to the PCR tube with the DNA
# Place 50 µL of the DNA/primer mix into the same tube.
# Add the second primer to the PCR tube
# Steps 2 and 3 are repeated for rest of the tubes.
# Add nucleotides to the PCR tube
# Place the tubes into the thermal cycler.
# Add the DNA polymerase to the PCR tube
# Place the PCR tube with all its contents into the thermal cycler
 




Line 107: Line 103:
==SNP Information & Primer Design==
==SNP Information & Primer Design==


'''Background: About the Disease SNP'''
'''Background: About the Disease SNP''' <br>
<!-- INSTRUCTIONS: This content is from PCR Lab B. Write a summary, at least five sentences long, about the disease SNP in your own words. -->
<!-- INSTRUCTIONS: This content is from PCR Lab B. Write a summary, at least five sentences long, about the disease SNP in your own words. -->
The single nucleotide polymorphism of rs121908757 is located in chromosome 7 for homo sapiens and is the Cystic Fibrosis Transmembrane Conductance Regulator gene, also known as CFTR.  CFTR is the gene that typically codes for the protein of cystic fibrosis transmembrane conductance regulator, which functions as a channel across the cell membranes that aid in the production of mucus, sweat, digestive enzymes and more. This channel carries the negative chloride ions in and out of cells, which aids in the movement of water in body tissue. If there is a mutation in the CFTR gene, not enough water reaches the body tissue to create a mucus that is able to flow smoothly and this is why cystic fibrosis patients have thick mucus which primarily affects the lungs. The specific point mutation of the SNP, rs121908757, is a missense mutation which is the change of one nucleotide which then alters the codon and a different protein is translated as a result. The missense mutation that causes cystic fibrosis in this case is the change of the AGT codon, which codes for Serine, to a CGT codon, which codes for Arginine.




'''Primer Design and Testing'''
'''Primer Design and Testing''' <br>
<!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. -->
<!-- INSTRUCTIONS: Write a short summary of the results of your primer test. Underneath your summary, include a screen capture of the results web page. You may crop the image so that it only includes the relevant information. -->
Results of the non-disease specific primer: <br>
Forward Primer: 5’ AGAAGGTGGAATCACACTGA 3’ <br>
Reverse Primer: 5’CATTATTTATAGTTCTTAAA 3’ <br>


The results of the non-disease specific primer test resulted in base pair measurement of 220 base pairs. This is accurate because the forward primer was twenty base pairs long and the reverse primer was 200 base pairs away from the SNP position. Since the reverse primer reads from the 5’ direction to the 3’ direction from right to left, the entire number of base pairs from is equal to 220. <br>


[[Image:Picture1BME.jpg]]


Results from the disease -specific primer: <br>
Forward Primer: 5’ CGAAGGTGGAATCACACTGA 3’ <br>
Reverse Primer: 5’CATTATTTATAGTTCTTAAA 3’ <br>


[[Image:Picture2BME.jpg]]


The results of the disease specific primer were inconclusive due to the missense mutation which causes the change of the SNP rs121908757. Since the disease specific primer is based off of the change in the nucleotide of the original sequence, it will not detect any base pair amount because the point mutation is not present in the database for the CFTR gene. <br>


<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### -->
|}
|}

Latest revision as of 06:31, 22 March 2017

BME 100 Spring 2017 Home
People
Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3
Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Anh Nguyen
Name: Sheridan Hill
Name: Derall Riley
Name: Kiryl Sheleg
Name: Thomas Andrews
Name: Skye Russell

LAB 4 WRITE-UP

Protocol

Materials

  • Lab coat and disposable gloves
  • PCR reaction mix, 8 tubes, 50 µL each: Mix contains Taq DNA polymerase, MgCl2 , and dNTP’s
  • DNA/ primer mix, 8 tubes, 50 µL each: Each mix contains a different template DNA. All tubes have the same forward primer and reverse primer
  • A strip of empty PCR tubes
  • Disposable pipette tips: only use each only once. Never reuse disposable pipette tips. If you do, the samples will become cross-contaminated
  • Cup for discarded tips
  • Micropipettor
  • OpenPCR machine: shared by two groups


PCR Reaction Sample List

Tube Label PCR Reaction Sample Patient ID
G2 + Positive control none
G2 - Negative control none
G2 1-1 Patient 1, replicate 1 20268
G2 1-2 Patient 1, replicate 2 20268
G2 1-3 Patient 1, replicate 3 20268
G2 2-1 Patient 2, replicate 1 49271
G2 2-2 Patient 2, replicate 2 49271
G2 2-3 Patient 2, replicate 3 49271


DNA Sample Set-up Procedure

  1. Label empty tubes with the information from the above table.
  2. Place 50 µL of the PCR reaction mix into the "positive control" tube. Don't forget to use a new pipette tip to avoid cross-contamination.
  3. Place 50 µL of the DNA/primer mix into the same tube.
  4. Steps 2 and 3 are repeated for rest of the tubes.
  5. Place the tubes into the thermal cycler.


OpenPCR program

Heated Lid: 100°C (or 212°F)
Primers bind at 50°C (or 122°F)
Initial Step: 95°C (or 203°F) for 2 minutes
Number of Cycles: 25
Denature at 95°C for 30 seconds
Anneal at 57°C (or 135°F) for 30 seconds
Extend at 72°C (or 162°F) for 30 seconds
Final Step: 72°C for 2 minutes
Final Hold: 4°C (or 39°F)

Research and Development

PCR - The Underlying Technology

The template DNA is the start point of the PCR process, it is what you are attempting to replicate, and is the base of the process. The primers are added, and are used to choose the specific area of DNA you are attempting to replicate. They target specific areas on the DNA, and attach to these areas to act as starting points for the replication. The DNA polymerase is then added; this is what actually builds the replicated strands of DNA by reading the DNA and attaching the appropriate nucleotides in the appropriate order. The dNTP’s are what actually make up the new DNA strand - these are the building blocks of DNA - adenine, guanine, cytosine, and thymine, and are matched by the polymerase to the original DNA strand to mirror the DNA.

The initial step, raising the temperature to 95℃ for 3 minutes serves to separate the DNA double helix. This is known as denture and creates two single-strand DNA codes over 30 seconds. After this, the temperature is lowered to 57℃ for 30 seconds which allows the primers to sneak in between the DNA strands and lock onto the target areas. This is the anneal. The temperature is then raised to 72℃ (extend) for 30 seconds which allows the polymerase to lock onto the primers and begin creation of the new, replicated strand of DNA. The temperature remains here for 3 minutes which then allows the polymerase to do its’ work of creating the new DNA strands. The temperature is then held at 4℃ for extraction and preservation of the new DNA

During this process, the adenine anneals to thymine and the cytosine anneals to guanine.

The base-pairing itself occurs during the annealing phase, when the primer first locks onto the target section that matches the nucleotides it holds. It also occurs during the final extension phase where the polymerase creates a new strand of DNA by base-pairing the DNA strand it is attached to.




SNP Information & Primer Design

Background: About the Disease SNP
The single nucleotide polymorphism of rs121908757 is located in chromosome 7 for homo sapiens and is the Cystic Fibrosis Transmembrane Conductance Regulator gene, also known as CFTR. CFTR is the gene that typically codes for the protein of cystic fibrosis transmembrane conductance regulator, which functions as a channel across the cell membranes that aid in the production of mucus, sweat, digestive enzymes and more. This channel carries the negative chloride ions in and out of cells, which aids in the movement of water in body tissue. If there is a mutation in the CFTR gene, not enough water reaches the body tissue to create a mucus that is able to flow smoothly and this is why cystic fibrosis patients have thick mucus which primarily affects the lungs. The specific point mutation of the SNP, rs121908757, is a missense mutation which is the change of one nucleotide which then alters the codon and a different protein is translated as a result. The missense mutation that causes cystic fibrosis in this case is the change of the AGT codon, which codes for Serine, to a CGT codon, which codes for Arginine.


Primer Design and Testing
Results of the non-disease specific primer:
Forward Primer: 5’ AGAAGGTGGAATCACACTGA 3’
Reverse Primer: 5’CATTATTTATAGTTCTTAAA 3’

The results of the non-disease specific primer test resulted in base pair measurement of 220 base pairs. This is accurate because the forward primer was twenty base pairs long and the reverse primer was 200 base pairs away from the SNP position. Since the reverse primer reads from the 5’ direction to the 3’ direction from right to left, the entire number of base pairs from is equal to 220.

Results from the disease -specific primer:
Forward Primer: 5’ CGAAGGTGGAATCACACTGA 3’
Reverse Primer: 5’CATTATTTATAGTTCTTAAA 3’

The results of the disease specific primer were inconclusive due to the missense mutation which causes the change of the SNP rs121908757. Since the disease specific primer is based off of the change in the nucleotide of the original sequence, it will not detect any base pair amount because the point mutation is not present in the database for the CFTR gene.