User:Alji: Difference between revisions
| Line 230: | Line 230: | ||
| YP-Tryptophan | | YP-Tryptophan | ||
| 30 C | | 30 C | ||
|} | |||
{| border="1" | |||
! Transformation | |||
! Number of Colonies | |||
|- | |||
| "Plus template" | |||
| 10 | |||
|- | |||
| "No template" | |||
| 3 | |||
|- | |||
| 50 ng pRS406 DNA | |||
| 800 | |||
|} | |} | ||
Revision as of 09:50, 30 April 2007
Andrew Ji
About Me
- Year: 2009
- Major: Biological Engineering
- Minor: Economics
- Email: alji AT mit DOT edu
M13K07 Genome Re-engineering ideas:
| Gene | Ideas |
|---|---|
| I | Change size of protein to see effect of different channel sizes. |
| II | Increase or decrease expression to optimize rate of + strand replication. |
| III | Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host. |
| IV | Change size of protein to see effect of different channel sizes. |
| V | Add more DNA binding sites to see if more DNA can be packaged into phage. |
| VI | Myc tag to monitor expression in phage and bacteria or to add other things to test initial interaction with host. |
| VII | Tag protein to monitor interaction with p5/DNA complex. |
| VIII | Change size of protein to experiment with the size of coat. |
| IX | Tag protein to monitor interaction with p5/DNA complex. |
| X | Increase expression to see if more phage leave the host E. coli. |
| XI | Change size of protein to see effect of different channel sizes. |
M13 Refactoring
I attempted to refactor the M13K07 phage by removing the overlapping areas of genes between the HpaI site of gene 2 and the BamHI site of gene 3. I did this by duplicating each gene (promoter, rbs, and ORF) and placing it after the ORF of the previous gene. I mutated the RBS's of each overlapping area to a silent mutation to prevent readout of the overlapping sections. There were 6 places of overlap, and I have included what changes I made. As a result, I have added 769 bp to the original section of DNA. In between each gene, I left 11 extra base pairs in order to introduce restriction sites so that each part can be manipulated individually. I want to see what others have done before attempting to introduce new restriction endonuclease sites.
| Overlapping Areas | Original Sequence | Modified sequence |
|---|---|---|
| Gene 2 ORF and Gene 10 RBS | At bp 478: gcatttgag | gcGtttgag |
| Gene 2 ORF and Gene 5 RBS | At bp 826: gcataaggt | gcGtaaggt |
| Gene 10 ORF and Gene 5 RBS | At bp 1286: gcataaggt | gcGtaaggt |
| Gene 5 ORF and Gene 7 RBS | At bp 1609: gttccggct | gtCccggct |
| Gene 7 ORF and Gene 9 RBS | At bp 1733: cgctggggg | cgAtggggg |
| Gene 9 ORF and Gene 8 RBS | At bp 1869: aatggaaac | aaCggaaac |
The refactored genome is Part BBa_M31332 on the Registry of Standard Biological Parts
SAGA subunits, S. cerevisiae
| Ada subunits | size,chromosome,null p-type | notes |
|---|---|---|
| Ada1 (aka HFI1, SUP110, SRM12, GAN1) | 1.467 kb/489 aa, Chr. XVI, viable |
|
| Ada2 (aka SWI8) | 1.305 kb/434aa, Chr. IV, viable |
|
| Ada3(aka NGG1, SWI7) | 2.109 kb/702aa, Chr. IV, viable |
|
| Gcn5 (aka ADA4, SWI9) | 1.32 kb/439aa, Chr. VII, viable |
|
| Ada5 (aka SPT20) | 1.815 kb/604aa, Chr. XV, viable |
| Spt subunits | size, chromosome, null p-type | notes |
|---|---|---|
| Spt3 | 1.014 kb/337aa, Chr. IV, viable |
|
| Spt7(aka GIT2) | 3.999 kb/1332aa, Chr. II, viable |
|
| Spt8 | 1.809 kb/602aa, Chr. XII, viable |
|
| Spt20 (aka Ada5) | 1.815 kb/604aa, Chr. XV, viable |
| TAF subunits | size, chromosome, null p-type | notes |
|---|---|---|
| TAF5 (aka TAF90) | 2.397 kb/798aa, Chr. II, inviable | |
| TAF6 (aka TAF60) | 1.551 kb/516aa, Chr. VII, inviable | |
| TAF9 (aka TAF17) | 0.474 kb/157aa, Chr. XIII, inviable | |
| TAF10 (aka TAF23, TAF25) | 0.621 kb/206aa, Chr. IV, inviable | |
| TAF12(aka TAF61, TAF68) | 1.620 kb/539aa, Chr. IV, inviable |
| Tra1 subunit | size, chromosome, null p-type | notes |
|---|---|---|
| Tra1 | 11.235 kb/3744aa, Chr. VIII, inviable |
| other subunits | size, chromosome, null p-type | notes |
|---|---|---|
| Sgf73 | 1.974 kb/657aa, Chr. VII , viable |
|
| Sgf29 | 0.779 kb/259aa, Chr. III, viable |
|
| Sgf11 | 0.3 kb/99aa, Chr.XVI, viable |
|
| Ubp8 | 1.416 kb/471aa, Chr. XIII, viable |
|
| Sus1 | gene with intron, Chr. II, viable |
| Primer | Primer Number | Sequence | Anneals |
|---|---|---|---|
| URA3 replacement PCR Forward Primer | NO177 | 5' GCGACAAAATCAGAAGTAACAATTCTGGCCTTCACTCCAatgtcgaaagctacatataa | 20 bp upstream of SUS1 |
| URA3 replacement PCR Reverse Primer | NO178 | 5' TGTAATAATATTGGGAATTAAGGTGCATTTTCGTATCCTttagttttgctggccgcatc | 20 bp downstream of SUS1 |
| Colony PCR Forward Primer | NO193 | 5' AATGGTTAAGATACCAATGCCGTCTACACC | 520 bp upstream of SUS1 |
| Colony PCR Reverse Primer | NO179 | 5' CTGTGCCCTCCATGGAAAAATCAGTCAAGA | 191-220 bp (btm strand) after URA3 ATG |
| Media | Temperature |
|---|---|
| YP Galactose | 23 C |
| YP Galactose | 30 C |
| YP Galactose | 37 C |
| YP Dextrose | 23 C |
| YP Dextrose | 30 C |
| YP Dextrose | 37 C |
| YP+Rapamycin | 30 C |
| YP-Lysine | 30 C |
| YP | 30 C |
| YP-Tryptophan | 30 C |
| Transformation | Number of Colonies |
|---|---|
| "Plus template" | 10 |
| "No template" | 3 |
| 50 ng pRS406 DNA | 800 |