IGEM:Harvard/2007/Laboratory Notebooks/Two Component System: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Svankudre (talk | contribs)
m New page: 6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system. The oligos ordered were as follows: Construct 1 5’- GTTTC...
 
Svankudre (talk | contribs)
mNo edit summary
Line 6: Line 6:




6/27/07 - Miniprepped bacteria (FecA, FecI, FecR) to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x.
[edit]
[edit]
6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:
SV001 - FecA plus VF2
SV002 - FecA plus VR
SV003 - FecR plus VF2
SV004 - FecR plus VR
SV005 - FecI plus VF2
SV006 - FecI plus VR

Revision as of 16:08, 28 June 2007

6/27/07 - Ordered oligos to create a FecA promoter BioBrick that can be used to recombine with GFP to create a reporter system.

The oligos ordered were as follows: Construct 1 5’- GTTTCTTCGAATTCGCGGCCGCTTCTAGAGatttcaccactgtaaggaaaataattcttatttc – 3’

Construct 2 5’- GTTTCTTCCTGCAGCGGCCGCTACTAGTAAGGGTAAAAAGGACAATCGAAATAAGAATTATTT – 3’


6/27/07 - Grew bacteria (FecA, FecI, FecR) in liquid culture to prepare for sequencing tomorrow, inoculation in 2 ml LB and 2 ul amp 50mg/ml 1000x. [edit]


6/28/07 - Miniprepped to prepare for sequencing, nanodropped to confirm presence of DNA, sequencing rxns:

SV001 - FecA plus VF2 SV002 - FecA plus VR SV003 - FecR plus VF2 SV004 - FecR plus VR SV005 - FecI plus VF2 SV006 - FecI plus VR