BE.109:Bio-material engineering/PCR of gold binding candidates: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Nkuldell (talk | contribs)
Nkuldell (talk | contribs)
Line 31: Line 31:
##4° forever  
##4° forever  


If we had more time today we would confirm that there is product in your reactions and we might even measure its concentration and remove the PCR salts and buffers before sending it off to the sequencing facility. Since there is insufficient time, we will blindly send it off and hope for the best. Sequencing reactions require 100-200 ng of DNA, and 6.4 pmoles of sequencing primer in a final volume of 24 ul. For each PCR product, make a 1:10 dilution in water and aliquot 2 ul to a full-sized eppendorf tube, labeled properly. A mixture of water and sequencing primer will be added (22ul) and the samples will be taken to the Biopolymer facility in E17 for sequencing. Keep your fingers crossed.  
While these reactions are cycling, you and your partner should work on the research proposal that you will present to the class next time.
 
If we had more time today we would confirm that there is product in your reactions and we might even measure its concentration and remove the PCR salts and buffers before sending it off to the sequencing facility. Since there is insufficient time, we will blindly send it off and hope for the best. Sequencing reactions require 100-200 ng of DNA, and 6.4 pmoles of sequencing primer in a final volume of 24 ul. For each PCR product, make a 1:10 dilution in water and aliquot 2 ul to a full-sized eppendorf tube, labeled properly. A mixture of water and sequencing primer will be added (22ul) and the samples will be taken to the Biopolymer facility in E17 for sequencing. The data will be available for you to examine one week from today. Keep your fingers crossed.  


DONE!
DONE!

Revision as of 21:02, 3 February 2006

BE.109 Laboratory Fundamentals of Biological Engineering

Home        Getting started        Lab        Presenting your work        People        Schedule       

DNA engineering        Protein engineering        Systems engineering        Bio-material engineering       


Introduction

Throughout the term you have used PCR. In the first experimental module you used it to engineer restriction sites that flanked the GFP truncation you were amplifying. In the third experimental module you used it to quantitate the number of transcripts of the lacZ gene when cells were grown under different experimental conditions. It is, perhaps, fitting then that the last bit of "wet lab work" you'll do this term will include PCR. Today you will be performing PCR to amplify the sequence fused to Aga2 in your best gold-binding library clones. The PCR will provide enough material to send to the biopolymer sequencing facility.

Based on the numerous applications of PCR, it may seem that the technique has been around forever. In fact it is only 20 years old. In 1984, Kary Mullis described this technique for amplifying DNA of known or unknown sequence, realizing immediately the significance of his insight.

Kary Mullis

"Dear Thor!," I exclaimed. I had solved the most annoying problems in DNA chemistry in a single lightening bolt. Abundance and distinction. With two oligonucleotides, DNA polymerase, and the four nucleosidetriphosphates I could make as much of a DNA sequence as I wanted and I could make it on a fragment of a specific size that I could distinguish easily. Somehow, I thought, it had to be an illusion. Otherwise it would change DNA chemistry forever. Otherwise it would make me famous. It was too easy. Someone else would have done it and I would surely have heard of it. We would be doing it all the time. What was I failing to see? "Jennifer, wake up. I've thought of something incredible." --Kary Mullis from his Nobel lecture; December 8, 1983

The PCR primers you will use today recognize sequences flanking the Aga2 fusion on the yeast display plasmid. After performing PCR, the DNA produced will be mixed with yet another primer that will serve as a starting point for the sequencing reactions.

To being today’s experiment, you will “pop” the gold-binding yeast from your library screen and then amplify the relevant portion of the released plasmid to send for sequencing. As the PCR runs, we will discuss the details of the upcoming lab report that will be due on the experiments you’ve performed.

Protocol

  1. Begin by counting the colonies that arose from the gold binding experiment you performed last time. The two library candidates that seem to have the highest affinity for gold will be sequenced.
  2. You will use the microwave to release the DNA from the yeast. On the tip of a sterile toothpick, pick-up a dab of the correct colony from your Petri dish and swirl it in 20 ul of sterile water in an eppendorf tube. Be sure to label the tube so you know it belongs to your group and which candidate it contains. Repeat with the second candidate you would like to sequence.
  3. Close the caps and microwave the tubes in an eppendorf rack for 15 seconds. If you haven’t been wearing gloves, start here. PCR is a sensitive technique and trace amounts of DNA from your fingertips can be detected. Before you proceed, clean up a bit, e.g. wash the barrels of your pipetmen with a paper towel and some 70% EtOH. You could also wash your bench area. Next, move 5 ul of the microwaved mix, yeast debris and all, into a 200 ul PCR tube that you will be given. Again label your tube well (write small!).
  4. Add 45 ul of PCR cocktail to each PCR tube and leave the tubes on ice until everyone is ready. The details of PCR will be discussed in experimental module 3 but the recipe and template sequences are listed at the end of today’s protocol if you have immediate questions.
  5. Cycle the reactions as:
    1. 94° 4 minutes
    2. 94° 1 minute
    3. 52° 1 minute
    4. 72° 2 minute
    5. repeat steps 2-4 35 times
    6. 72° 10 minutes
    7. 4° forever

While these reactions are cycling, you and your partner should work on the research proposal that you will present to the class next time.

If we had more time today we would confirm that there is product in your reactions and we might even measure its concentration and remove the PCR salts and buffers before sending it off to the sequencing facility. Since there is insufficient time, we will blindly send it off and hope for the best. Sequencing reactions require 100-200 ng of DNA, and 6.4 pmoles of sequencing primer in a final volume of 24 ul. For each PCR product, make a 1:10 dilution in water and aliquot 2 ul to a full-sized eppendorf tube, labeled properly. A mixture of water and sequencing primer will be added (22ul) and the samples will be taken to the Biopolymer facility in E17 for sequencing. The data will be available for you to examine one week from today. Keep your fingers crossed.

DONE!

For next time

  1. Prepare a table presenting the plating results of your library rescreening as well as a short description of the experiment to go with the table. Include enough information so a person who didn’t do the experiment would understand the table, but not a step-by-step protocol.
  2. Practice sequence analysis using the pCT-CON and pAu1 files on the website and the following link: http://www2.ebi.ac.uk/translate/ The flow should be relatively intuitive but here are some brief instructions in case you are stuck. Open a sequence file (.seq) which is an Excel worksheet. Select all. Copy. Go to link. Paste. Translate sequence by clicking “Generate Protein” in each reading frame (no need to generate complements). You can color (“colour”) the protein if you want. Use the attached page to remind you of the structure and chemistry of the amino acids as well as the single- and three-letter amino acid abbreviations.
    Translate in all three reading frames and paste each output into a word document.

Reagents list

  • PCR forward primer (100 pmole/ul)
    CAAATGTAATAAAAGATCGAATTCTACTTCATACATTTTCAATT
  • PCR reverse primer (100 pmole/ul)
    GAACAAAGTCGTTTTTGTTACCTATACACTGTTG
  • Sequencing primer (1 pmole/ul)
    GACAATAGCTCGACGATTGAAGGTAG
  • PCR Master Mix (2.5X)
    • 62.5 U/ml Taq DNA Polymerase
    • 125 mM KCl
    • 75 mM Tris-HCl, pH 8.3
    • 3.75 mM Mg(OAc)2
    • 500 uM each dNTP