User:Katherine H. Loh: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| Line 11: | Line 11: | ||
*[[Special:Emailuser/Katherine H. Loh|Email me through OpenWetWare]] | *[[Special:Emailuser/Katherine H. Loh|Email me through OpenWetWare]] | ||
==Art/Biotechnology Exhibit== | |||
===Current interactions between science and the public=== | |||
===Goals and summary=== | |||
===Plans=== | |||
*Exhibit | |||
# Timing diagram | |||
# "Parts" and "devices" | |||
*Laboratory | |||
# First experimental steps | |||
# Control experiment | |||
===Resources=== | |||
===Societal Impact=== | |||
==Mod 2: Protein Engineering== | ==Mod 2: Protein Engineering== | ||
Revision as of 01:10, 10 November 2008
I am a new member of OpenWetWare!
Contact Info

- Katherine H. Loh
- Massachusetts Institute of Technology
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
Art/Biotechnology Exhibit
Current interactions between science and the public
Goals and summary
Plans
- Exhibit
- Timing diagram
- "Parts" and "devices"
- Laboratory
- First experimental steps
- Control experiment
Resources
Societal Impact
Mod 2: Protein Engineering
Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Loh
First Name
Katherine
Preferred name
Katie
Course/Minor
20
Year of Graduation
2011
Telephone #
kloh AT mit DOT edu
Anything else you would like us to know?
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164