User:Katherine H. Loh: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 11: Line 11:
*[[Special:Emailuser/Katherine H. Loh|Email me through OpenWetWare]]
*[[Special:Emailuser/Katherine H. Loh|Email me through OpenWetWare]]


I work in the [[Your Lab]] at XYZ University.  I learned about [[OpenWetWare]] from 20.109, and I've joined because 20.109.
==Art/Biotechnology Exhibit==
===Current interactions between science and the public===
===Goals and summary===
===Plans===
*Exhibit
# Timing diagram
# "Parts" and "devices"
*Laboratory
# First experimental steps
# Control experiment
===Resources===
===Societal Impact===


==Mod 2: Protein Engineering==
==Mod 2: Protein Engineering==

Revision as of 01:10, 10 November 2008

I am a new member of OpenWetWare!

Contact Info

Katherine H. Loh (an artistic interpretation)

Art/Biotechnology Exhibit

Current interactions between science and the public

Goals and summary

Plans

  • Exhibit
  1. Timing diagram
  2. "Parts" and "devices"
  • Laboratory
  1. First experimental steps
  2. Control experiment

Resources

Societal Impact

Mod 2: Protein Engineering

Day 1: PCR Primers Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’

Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’

Registration/Questionnaire: 20.109 Fall 2008

Last Name

Loh

First Name

Katherine

Preferred name

Katie

Course/Minor

20

Year of Graduation

2011

Telephone #

Email

kloh AT mit DOT edu


Anything else you would like us to know?

Education

  • Year, PhD, Institute
  • Year, MS, Institute
  • Year, BS, Institute

Research interests

  1. Interest 1
  2. Interest 2
  3. Interest 3

Publications

  1. Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 | PubMed ID:6947258 | HubMed [Paper1]
  2. JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 | PubMed ID:13718526 | HubMed [Paper2]

    leave a comment about a paper here

  3. ISBN:0879697164 [Book1]

All Medline abstracts: PubMed | HubMed