User:Katherine H. Loh: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(5 intermediate revisions by the same user not shown)
Line 1: Line 1:
<!-- Delete this entire line as part of your first edit of your user page --> {{New user}}
==Art/Biotechnology Exhibit==
==Art/Biotechnology Exhibit==
===Current interactions between science and the public===
===Current interactions between science and the public===


a description of existing ways the public can interact with science (and/or) how a new model for an interactive laboratory can fit into the history of science and knowledge (and/or) your ideas about citizenship and biological engineering
Public perceptions of science are shaped largely by the few high-profile breakthroughs propagated through the media.  As a result, the general public often cannot appreciate menial successes and are not involved in the entire scientific process.  Currently, there are some innovative and often artistic interfaces where the public can approach science differently; these lead to a better understanding and improved appreciation of the elegance of science. For example, groups such as the League of Imaginary Scientists try to make scientific concepts more accessible through videos, art exhibits, etc. Additionally, the Science Gallery at Trinity College in Dublin houses displays which encourage viewers to see science from new and different perspectives. Still, further promotion of the interaction between the public and science is needed, and we hope to expand these levels of interaction.
 
Public perceptions of science are shaped largely by the few high-profile breakthroughs propagated through the media.  As a result, the general public often cannot appreciate menial successes and are not involved in the entire scientific process.  Currently, there are some innovative and often artistic interfaces where the public can approach science differently; these lead to a better understanding and improved appreciation of the elegance of science. For example, groups such as the League of Imaginary Scientists try to make scientific concepts more accessible through videos, art exhibits, etc. Additionally, the Science Gallery at Trinity College in Dublin houses displays which encourage viewers to see science from new and different perspectives. Still, further promotion of the interaction between the public and science is needed, and a new model for an interactive laboratory can help pave the way to.......


===Partial Ideas!===
===Partial Ideas!===
Line 48: Line 42:
===Resources===
===Resources===
(linked above)
(linked above)
==Mod 2: Protein Engineering==
Day 1: PCR Primers
Forward primer:
FLAP             landing sequence
5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA  tccatggaaaagagaagatg 3’
Reverse Primer:
FLAP landing sequence
5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT  tacgactcactatagggcga 3’


==Useful links==
==Useful links==
*[[OpenWetWare:Welcome|Introductory tutorial]]
*[[OpenWetWare:Welcome|Introductory tutorial]]
*[[Help|OpenWetWare help pages]]
*[[Help|OpenWetWare help pages]]
==Contact Info==
*Katherine H. Loh
*Massachusetts Institute of Technology
*[[Special:Emailuser/Katherine H. Loh|Email me through OpenWetWare]]

Latest revision as of 18:01, 16 November 2008

Art/Biotechnology Exhibit

Current interactions between science and the public

Public perceptions of science are shaped largely by the few high-profile breakthroughs propagated through the media. As a result, the general public often cannot appreciate menial successes and are not involved in the entire scientific process. Currently, there are some innovative and often artistic interfaces where the public can approach science differently; these lead to a better understanding and improved appreciation of the elegance of science. For example, groups such as the League of Imaginary Scientists try to make scientific concepts more accessible through videos, art exhibits, etc. Additionally, the Science Gallery at Trinity College in Dublin houses displays which encourage viewers to see science from new and different perspectives. Still, further promotion of the interaction between the public and science is needed, and we hope to expand these levels of interaction.

Partial Ideas!

Yeast light bulb

  • observe/cause: colony patterns, size, clumping/multiplication, color change
  • see previous changes, record of what has happened - different time scale
  • fluorophore
  • gradient of environment
  • displays of proteins
  • can produce ethanol
    • simple sugar (fructose, glucose, galactose) --> ethanol
    • time scale: 13-164 minutes?


Bacteria (fast-forwarded)

  • show movement and interaction of (maybe different kinds of) bacteria to show their behaviors on a different time scale
  • Planet Earth


C.elegans


Funny cheese!

  • present food/products made using bacteria etc. in different ways i.e. arrange petri dishes in the shape of swiss cheese with bacteria where the holes should be
  • GFPixel

Societal Impacts

Plans (to be filled in later)

  • Exhibit
  1. Timing diagram
  2. "Parts" and "devices"
  • Laboratory

Resources

(linked above)

Contact Info