Synthetic Biology:Vectors/Parts: Difference between revisions
No edit summary |
|||
| Line 95: | Line 95: | ||
><bbpart>BBa_I52000</bbpart> ccd with high copy origin Length: 1320 Base Pairs Including Part and Barcode | ><bbpart>BBa_I52000</bbpart> ccd with high copy origin Length: 1320 Base Pairs Including Part and Barcode | ||
*><bbpart>BBa_P1011</bbpart> ccdB cassette Length: 454 Base Pairs Including Part and Barcode | |||
*><bbpart>BBa_I50020</bbpart> High copy origin of replication Length: 858 Base Pairs Including Part and Barcode | |||
====Intact vector==== | ====Intact vector==== | ||
Revision as of 01:51, 17 March 2006
This is a list of BioBricks parts for use in construction of modular vectors.
Some have just been designed while others have been constructed and tested. See the associated registry page for details.
Replication origins
- <bbpart>BBa_I50000</bbpart>: F plasmid backbone with BioBricks restriction sites removed.
- <bbpart>BBa_I50001</bbpart>: F plasmid backbone with BioBricks restriction sites removed, reverse orientation.
- <bbpart>BBa_I50010</bbpart>: oriV origin which requires TrfA protein to be functional.
- <bbpart>BBa_I50020</bbpart>: high copy origin of replication from pSB1A3
- <bbpart>BBa_I50030</bbpart>: a pBR322 origin.
- <bbpart>BBa_I50040</bbpart>: a near minimal pSC101 origin.
- <bbpart>BBa_I50041</bbpart>: a near minimal pSC101 origin, reverse orientation.
- <bbpart>BBa_I50050</bbpart>: a R6K gamma origin. See also EZ-Tn5™ <R6Kγori /KAN-2> Sequence general information (Note: this origin will only replicate in a pir+ strain.)
Antibiotic resistance cassettes
- <bbpart>BBa_P1001</bbpart>: cassette providing tetracycline resistance.
- <bbpart>BBa_P1000</bbpart>: cassette providing chloramphenicol resistance.
- <bbpart>BBa_P1002</bbpart>: cassette providing ampicillin resistance.
- <bbpart>BBa_P1003</bbpart>: cassette providing kanamycin resistance.
- <bbpart>BBa_P1004</bbpart>: cassette providing ampicillin resistance in reverse orientation.
- <bbpart>BBa_P1005</bbpart>: cassette providing tetracycline resistance and ampicillin resistance with terminators.
- <bbpart>BBa_P1006</bbpart>: cassette providing chloramphenicol resistance and ampicillin resistance with terminators.
- <bbpart>BBa_P1007</bbpart>: cassette providing kanamycin resistance and ampicillin resistance with terminators.
Terminators
- <bbpart>BBa_B0055</bbpart>: upstream flanking terminator
- <bbpart>BBa_B0054</bbpart>: downstream flanking terminator
- <bbpart>BBa_B0053</bbpart>: bidirectional terminator from E. coli his operon
- <bbpart>BBa_B0052</bbpart>: forward terminator
- <bbpart>BBa_B0062</bbpart>: reverse terminator of BBa_B0052.
Notes
It wasn't clear from the website if these were bi-directional? Not sure that this is very important--BC
- I don't know if the terminators are bidirectional. These terminators are used as flanking terminators in other vectors and are claimed to make the cloning of difficult pieces of DNA (like strong promoters) easier. This is why I was planning on orienting the antibiotic resistance cassette in the opposite direction so that read through from upstream of the multiple cloning site is less of an issue. -- RS
Primer binding sites
- <bbpart>BBa_G00100</bbpart>: VF2
- <bbpart>BBa_G00102</bbpart>: VR
Others
- <bbpart>BBa_P1010</bbpart>: ccd operon in BioBricks format
- <bbpart> BBa_P1011</bbpart>: ccdB cassette in BioBricks format (ccdA- has been removed)
- <bbpart>BBa_B0042</bbpart>: translational stop sequence which provides a stop codon in all six frames (see Non-functional DNA sequences)
- <bbpart>BBa_B0043</bbpart>: forward Topoisomerase I cloning site (see Topoisomerase I mediated TA cloning)
- <bbpart>BBa_B0044</bbpart>: reverse Topoisomerase I cloning site (see Topoisomerase I mediated TA cloning)
- <bbpart>BBa_G00000</bbpart>: BioBricks prefix
- <bbpart>BBa_G00001</bbpart>: BioBricks suffix
- <bbpart>BBa_B0045</bbpart>: antibiotic cassette insertion site (see Synthetic Biology:Vectors/Modular construction scheme)
- <bbpart>BBa_B0046</bbpart>: replication origin insertion site (see Synthetic Biology:Vectors/Modular construction scheme)
- unique identifier for the vector
Minimal vector scaffold
5' <counter-selectable marker> -- <high copy origin> -- BBa_G00001 (BBsuffix) -- BBa_B0044 (TOPO site) -- BBa_B0042 (translational stop sequence) -- <plasmid barcode> -- BBa_B0054 (terminator) -- BBa_G00102 (VR) -- BBa_B0045 (antibiotic resistance insertion site) -- BBa_B0046 (origin insertion site) -- BBa_G00100 (VF2) -- BBa_B0055 (terminator) -- <plasmid barcode> -- BBa_B0042 (translational stop sequence) -- BBa_B0043 (TOPO site) -- BBa_G00000 (BB prefix) 3'
Ordering information
Independently synthesized components
(This information is for DNA synthesis companies).
Vector scaffold
><bbpart>BBa_I51000</bbpart> Minimal vector scaffold Length: 408 Base Pairs Including Part and Barcode Circular
This sequence is the vector scaffold. Into this sequence there are different inserts we'd like to put in at 3 separate locations (the antibiotic resistance marker, the replication origin and the insert). I've listed the optional inserts for each location below. If we get the vector scaffold synthesized without an insert at a particular location then the bases TACTAGAG should be the placeholder sequence at that location.
tactagtagcggccgctgcagtactagaggagtcactaagggtactagagttagttagttagtactagagattagcagaa agtcaaaagcctccgaccggaggcttttgactaaaacttcccttggggttatcattgggtactagaggctcactcaaagg cggtaattactagaggctagc<tactagag OR antibiotic resistance marker>atgcattactagagcaattg <tactagag OR replication origin> cctaggtactagagtgccacctgac gtctaagaatactagagaaggaatattcagcaatttgcccgtgccgaagaaaggcccacccgtgaaggtgagccagtgag ttgattgctacgtaatactagagttagttagttagtactagagcccttagtgactctactagaggaattcgcggccgctt ctagag<tactagag or insert>
Antibiotic resistance marker
We want four different resistance markers. For these parts, in addition to getting them inserted into the vector at the location specified above, we'd also want them as linear pieces in BioBricks format. The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same. We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that. For all of our variants we will want to include both one of BBa_P1000/BBa_P1001/BBa_P1003 and BBa_P1008 in the antibiotic insertion site.
><bbpart>BBa_P1000</bbpart> CmR Length: 789 Base Pairs Including Part and Barcode
><bbpart>BBa_P1001</bbpart> TetR Length: 1279 Base Pairs Including Part and Barcode
><bbpart>BBa_P1003</bbpart> KanR Length: 993 Base Pairs Including Part and Barcode
><bbpart>BBa_P1008</bbpart> Terminator.AmpR.Terminator Length: 1070 Base Pairs Including Part and Barcode
Replication origin
We want two different replication origins. For these parts, in addition to getting them inserted into the vector at the location specified above, we'd also want them as linear pieces in BioBricks format. The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same. We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that.
><bbpart>BBa_I50001</bbpart> F plasmid backbone with BioBrick sites removed, reverse Length: 4640 Base Pairs Including Part and Barcode
><bbpart>BBa_I50041</bbpart> pSC101 origin of replication, reverse Length: 2215 Base Pairs Including Part and Barcode
Insert
There is only one option for the insert. I only include it separately because depending on cost, we may or may not get it synthesized. The sequence of these pieces will likely change in the event we get them synthesized but the length should stay pretty much the same. We have some flexibility in the exact sequence of these pieces so if by including or excluding some restriction sites, it becomes cheaper/easier for you to clone, we might be able to do that. Note that this sequence encodes ccdB, a toxic gene to E. coli, and therefore will only propagate in special strains which have a mutation that confers resistance to ccdB (i.e. DB3.1)
><bbpart>BBa_I52000</bbpart> ccd with high copy origin Length: 1320 Base Pairs Including Part and Barcode
- ><bbpart>BBa_P1011</bbpart> ccdB cassette Length: 454 Base Pairs Including Part and Barcode
- ><bbpart>BBa_I50020</bbpart> High copy origin of replication Length: 858 Base Pairs Including Part and Barcode
Intact vector
In total, there are 3 antibiotic resistance choices * 2 replication origins = 6 total intact vector combinations.
This is one out of the six possible intact vectors that we would like to get synthesized. It has the insert, both BBa_P1000 and BBa_P1008 as the antibiotic resistance markers and BBa_I50001 origin in the appropriate locations. We would want this returned as circular DNA.
><bbpart>pSB5AC4</bbpart> pSB5AC4 Length: 8257 Base Pairs Including Part and Barcode
Individual vector BioBrick parts
| Part number | Description | Size | BioBrick available | Template available | Want synthesized as an individual part |
| BASIC PARTS | |||||
| BBa_P1010 | ccd | 675bp | Yes | Yes | No |
| BBa_P1011 | ccdB | 454bp | No | No | Yes |
| BB suffix | 21bp | No | No | No (can make with primers) | |
| BBa_B0044 | TOPO site | 13bp | No | No | No (can make with primers) |
| BBa_B0042 | translational stop sequence | 12bp | No | No | No (can make with primers) |
| plasmid barcode | |||||
| BBa_B0054 | terminator | 69bp | No | No | Maybe (can be hard to make terminators with primer extension) |
| BBa_G00102 | VR | 20bp | No | No | No (can make with primers) |
| BBa_I50000 | F plasmid origin | 4640bp | No | No | No |
| BBa_I50001 | F plasmid origin, reverse orientation | 4640bp | No | No | Yes (has 4 BioBricks sites throughout the gene) |
| BBa_I50020 | high copy origin (pUC19) | 858bp | No | Yes | Maybe |
| BBa_I50040 | low copy origin (pSC101) | 2215bp | No | Yes | No |
| BBa_I50041 | low copy origin (pSC101) | 2215bp | No | Yes | Maybe (redundant with BBa_I50030, have template) |
| BBa_I50030 | low copy origin (pBR322) | 2016bp | No | Yes | Maybe (redundant with BBa_I50040) |
| BBa_P1000 | CmR | 789bp | Yes (Austin) | Yes | No |
| BBa_P1001 | TetR | 1279bp | Yes (Austin) | Yes | No |
| BBa_P1003 | KanR | 993bp | Maybe (TK) | Yes | Maybe |
| BBa_B0053 | His terminator | 72bp | No | No | Yes (previous synthesis attempt via primer extension failed) |
| BBa_B0062 | reverse rrnC terminator | 41bp | No | No | Maybe (can be hard to make terminators with primer extension) |
| BBa_P1004 | reverse AmpR | 941bp | No | Yes | Maybe |
| BBa_G00100 | VF2 | 20bp | No | No | No (can make with primers) |
| BBa_B0055 | terminator | 78bp | No | No | Maybe (can be hard to make terminators with primer extension) |
| plasmid barcode | |||||
| BBa_B0042 | translational stop sequence | 12bp | No | No | No (can make with primers) |
| BBa_B0043 | forward TOPO site | 13p | No | No | No (can make with primers) |
| BB prefix | 22bp | No | No | No (can make with primers) | |
| COMPOSITE PARTS | |||||
| BBa_P1005 | tetR and ampR | 1867bp | No | No | Maybe |
| BBa_P1006 | cmR and ampR | 2357bp | No | No | Maybe |
| BBa_P1007 | kanR and ampR | 2071bp | No | No | Maybe |