SBB09Ntbk-John Wang: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 14: Line 14:
== '''3-13-2009''' ==
== '''3-13-2009''' ==
I updated my sequence log as well as my progress. My sequences came back ALL PERFECT! HELL YEAH!<br>
I updated my sequence log as well as my progress. My sequences came back ALL PERFECT! HELL YEAH!<br>
Well 67 TTCAACATGCAGTGCCAGCGTCGTTTCTACGAAGCTCTGCACGACCCGAACCTGAACGAAGAACAGCGTAACGCTAAAATCAAATCTATCCGTGACGACTGC<br>
Well 67 <br> TTCAACATGCAGTGCCAGCGTCGTTTCTACGAAGCTCTGCACGACCCGAACCTGAACGAAGAACAGCGTAACGCTAAAATCAAATCTATCCGTGACGACTGC<br>
Well 68<br>  
Well 68<br>  
GACTACAAGGATGACGACGACAAG<br>
GACTACAAGGATGACGACGACAAG<br>

Revision as of 18:53, 15 March 2009

Protein A
Flag

Concurrent notes about my project- My project is to find a engineered protein A. Protein A is an antigen which has been known to bind to IgG. The two papers I choose for designing my part are:
Actual Sequence
How they got to the sequence

The key idea in the papers was that protein A is a protein found in Staphylococcus aureus. The protein is good at taking out IgG antibodies by binding to them. There's two sites on IgG that it can bind to. The fab and the fc portions. The fab is of the the 2 heads of the y antibody and the fc is that tale. Since we're only interesting in the tail, an effort was made to find the smallest protein domain possible that still binds to the fc portion of IgG. What I initially didn't understand was why they were expressing conformations of protein A in phages. As it turns out, they were using phages to select for smaller proteins which still bind. Thus they came up with the Z38. However, Z38 turned out to be unstable which lead to the development of Z34c which actually bind much tighter than Z38 to fc, but loses the ability to bind to fab.

ProTips for Editing
Go Back

3-13-2009

I updated my sequence log as well as my progress. My sequences came back ALL PERFECT! HELL YEAH!
Well 67
TTCAACATGCAGTGCCAGCGTCGTTTCTACGAAGCTCTGCACGACCCGAACCTGAACGAAGAACAGCGTAACGCTAAAATCAAATCTATCCGTGACGACTGC
Well 68
GACTACAAGGATGACGACGACAAG


Note: 68 does match the amino acid sequence DYKDDDDK after translation
68 corresponds to the paper pubmed id: 12536251

3-09-2009

Prelab
Just doing a little preparation this time. I'm going to run: 1 mini prep + gel on my protein A. 1 gel for my gateway. I'm going to start with the gel so I can run it with Sam. Then I'm going to mini prep. I don't need P10s for mini prep so I should be fine with the equipment.

Gel Instructions:
Analytical digests (Mapping)
Set up the following 10uL reaction in a PCR tube:

6.5 uL ddH2O
2uL Miniprepped plasmid
1uL 10x NEB Buffer 2
0.5uL EcoRI
0.5uL BamHI (for parts >250bp) or XhoI (for parts <250bp)

Incubate at 37 on the thermocycler for 30 minutes Run an analytical gel Take a picture of the gel Calculate the expected fragment sizes Are the calculated sizes consistent with the bands on the gel?

Protips
-use 5microliters of ladder
-1ul of 6x corresponds to 6ul. 1ul of 10x corresponds to 10ul
-spin your your tube after using the loading dye.

Alright so finished my mini prep before class and I ran my gel with my protein a and gateway at the same time. My lanes were:
1. gateway 1
2. gateway 2
3. protein a 1
4. protein a 2

All of the bands came up as 1kb. This is VERY GOOD. This is because the part (less that 250 base pairs) + the 1k back bone adds up to around 1k base pairs.

Also, I totally sequenced my stuff. I updated the sequence list, wrote the stuff on the board and gave my stuff to Chris.

If my stuff sequences properly (prays to god) then I'm set.

3-06-2009

I got my culture back from my second try at the protein A BglBrick part. Unfortunately, there was a mix up and my tray was never put into the incubator. Gab says it's fine though so it's going into the incubator now. Also, I ran my miniprep for my gateway reaction. I ran it with a group since we had to share the spinner. I analyzed my gels from my failed first attempt at the protein A. According to my predicted results, I should have 2 bands. In both of the gels, I got 1 band. Gab says to hold off sequencing my first tries until I finish my second try's gels.

I showed my crazy reach over recombinase project to Chris. As it turns out there isn't such a thing as a reach over recombinase. DOH!

3-04-2009

TODAY WAS EXHAUSTING.

So first, I noticed that I had 2 tubes both labels JWI from my initial experiment. I was doing the first part of the experiment sequencially and I forgot to throw out a tube. From now on, I am not only labeling the experiment number and my initials but the step that it is at.

To rectify this, I ran 2 gels and based on the size, I'll determine which tube has my product. I used a XhoI instead of BamhI since I have a wobble.

I took a picture of the finished gel and uploaded it via flash drive to the gel pics page. I labeled with one's which. My order went ladder, a, then b. I'll try and see if I can interpret the ladder and confirm with a GSI tomorrow before I send the correct tube into the sequencer.

Next, I transformed my start over experiment (JWIII). I ligated and transformed.

While that was happening, I also ran my gateway for my flag part. A lot of us weren't sure if we were doing it as a group after we put them inside the incubator or we were individually doing it so it took extra time. I had to stay after a little bit. SORRY GSIs!

To do: Lastly, I need to rearticulate my project idea and present it to Chris tomorrow. Also, I need to reread that article and completely confirm that there is such a thing as a downstream dna recombinase.

3-02-2009

Today I ran my start over sample through zymo clean up- digestion- zymo clean up.

I also mapped my original sample (2 microliters). I gel came up crappy, so I may need to run another gel later. I used 10 microliters of ladder. Gab suggested that I use half that amount next time.

I updated my protocol to include the analytical gel step as well as ligation. Furthermore, I now understand why I CAN run an analytical gel on a wobble now. I digested with Ecori and XhoI instead of BamhI. The reason is to include the antibiotic resistance with my part. This way I can actually get a ready on my gel. My fragment size should include my wobble as well as the antibiotic resistance. In my case it would be A and K. (Amp and KanR)

2-27-2009

Today I did my mini prep. The TAs already picked the colonies and incubated. All we need to do is mini prep the vials.

Since I only had 1 colony on my plate, I was advised by Chris to start over. I started over and finished up to the PCR step.

Also, I started over a fresh experiment in case I didn't do it right the first time. My plate was "suspicious" because there was only 1 colony. The dntps were of the wrong concentration the first time I started over so I did it over again with Gab making a fresh dntp set with the right concentration (2 mmol instead of 10 mmol).

2-24-2009

Today I ligated and transformed my stuff. I wondered about why I was putting my ligation on ice for the transformation part. I asked Tim who explained that the idea is that I ice it then warm it and that heat shock will create pores on the bacteria which will allow for the DNA to go in. We're waiting 10 minutes because we want to give the dna time to go in. Also, I just wanted to note a tip when spreading onto the plate, if it sizzles, you know it's too hot.

2-23-2009

I ran both of my reaction through small frag zymo clean up, digest, and another small frag zymo cleanup. My first batch was successful. On my second batch there was an unfortunately side affect when my lab partner accidentally grabbed the PB buffer instead of the PE buffer. I decided to scrap my second experiment since it was corrupted at that step anyways. In the end I had a 50 nM (probably less if I lost product along the way) product.

2-18-2009

I did my reaction. A piece of a wool sweater fell into my initial reaction so I had to redo it. My initial concentrations were 60.2nm and 55.5nm and so I had to dilute to 602ul of water and 555ul of water respectively. I had extra time and I ended up doing the experiment twice. I kept the second sample as a safety in case my first one was corrupted. I ran my experimental protocol up until the PCR step.

2-16-2009

So I did a bit of cleaning on my wiki page and created: http://openwetware.org/wiki/Protein_A_FLAG_Tag_M10018_M10019

I suppose I am going to finish my zymo clean-up. Not sure if I'll be able to start digestion unless I have an hour and 30 left. If I can just finish digestion, that would make my life a lot easier next time.

Also I'm adding a link to the gateway reaction for my second part just for my own convenience: Flag

2-6-2009

Today I made my openwetware notebook page.