Primer Tm estimation methods: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
ficticous primer |
links |
||
| Line 53: | Line 53: | ||
: [http://www.basic.northwestern.edu/biotools/oligocalc.html online tool] using Wallace formula for oligos >13 | : [http://www.basic.northwestern.edu/biotools/oligocalc.html online tool] using Wallace formula for oligos >13 | ||
* Breslauer et al. 1986, | * Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae | ||
: [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility | : [http://frodo.wi.mit.edu/primer3/ Primer3] and [http://www.bioinformatics.nl/cgi-bin/primer3plus/primer3plus.cgi Primer3Plus] default maintained for backwards compatibility | ||
* SantaLucia 1998, | * SantaLucia 1998, PMID 9465037 thermodynamics & salt correction | ||
: Primer3 recommended setting; also default settings of the NCBI's [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Primer BLAST] | : Primer3 recommended setting; also default settings of the NCBI's [http://www.ncbi.nlm.nih.gov/tools/primer-blast/ Primer BLAST] | ||
Revision as of 08:49, 28 September 2009
| example primer | Marmur rule | Wallace rule | Breslauer '86 | SantaLucia '98 |
|---|---|---|---|---|
| 50/50 mixed: AGAGAGAGAGAGAGAGAGAG | 60 | 52 | 46.3 | 47.7 |
| 50/50 separated: AAAAAAAAAAGGGGGGGGGG | 60 | 52 | 66.0 | 52.7 |
| ActB F: TTGCTGACAGGATGCAGAAG | 60 | 52 | 60.1 | 52.4 |
| ActB R: TGATCCACATCTGCTGGAAG | 60 | 52 | 59.8 | 51.5 |
| Tubb5 F: GATCGGTGCTAAGTTCTGGGA | 64 | 54 | 61.5 | 53.7 |
| Tubb5 R: AGGGACATACTTGCCACCTGT | 64 | 54 | 60.8 | 55.1 |
- Marmur formula: Tm = 4 x GC + 2 x AT
- not recommended for more than 13nt; assumes 50mM monovalent cations
- Marmur J and Doty P (1962) J Mol Biol 5:109-118; PMID 14470099
- Wallace formula: Tm = 64.9 +41*(yG+zC-16.4)/(wA+xT+yG+zC)
- Wallace RB et al. (1979) Nucleic Acids Res 6:3543-3557, PMID 158748
- online tool using Wallace formula for oligos >13
- Breslauer et al. 1986, PMID 3459152 combined with Schildkraut et al. 1965, PMID 5889540 salt correction formulae
- Primer3 and Primer3Plus default maintained for backwards compatibility
- SantaLucia 1998, PMID 9465037 thermodynamics & salt correction
- Primer3 recommended setting; also default settings of the NCBI's Primer BLAST