MurrayRM:PURExpress system notes and experience: Difference between revisions
| Line 35: | Line 35: | ||
==== PG3 ==== | ==== PG3 ==== | ||
This plasmid consists of lacI on a constitutive T7-promoter. It is constructed by inserting lacI into the PURE control plasmid (in place of DHFR). To do this, we need to make a copy of lacI, put restriction sites and then insert this into the control plasmid. | |||
==== LR4 ==== | ==== LR4 ==== | ||
Revision as of 18:15, 12 February 2010
Notes on using the NEB PURExpress system.
Worked example: inducible expression
To illustrate how the system works, this section describes an experiment to test out four different constructs:
- PG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid (fluoresce)
- LG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035 (fluoresce)
- LG2 + PG3 (T7:RBS:lacI) - linear GFP on a LacI-repressible promoter with lacI on a constitutive T7 promoter on a plasmid (not fluoresce)
- LG2 + PG3 + 100 uM IPTG - GFP on a LacI-repressible promoter with lacI and IPTG present (fluoresce)
In addition, an RFP-based construct was developed, just in case I couldn't get access to BBa_I2035 and a constitutive T7-based lacI using a biobrick part:
- LR4 (T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.
- LG5 (T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.
DNA construction
Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences were constructed using PCR-based editing.
PG1
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
LG2
This is linear DNA extracted from BBa_I2035 using a simple forward and reverse primer. The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter is tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
- Forward primer: tcatacgactcactataggggaat
- Reverse primer: aaacgggtcttgaggggttttttg
PG3
This plasmid consists of lacI on a constitutive T7-promoter. It is constructed by inserting lacI into the PURE control plasmid (in place of DHFR). To do this, we need to make a copy of lacI, put restriction sites and then insert this into the control plasmid.
LR4
(T7-Plac:RBS:RFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from plasmid provided by Karsten Temme at UCSF. This can be used as a replacement for LG2, if needed.
LG5
(T7-RBS:lacI) - linear DNA with with LacI on a constitutive T7 promoter, constructed from BBa_2043. This can be used as a replacement for PG3, if needed.