MurrayRM:PURExpress system notes and experience: Difference between revisions
| Line 49: | Line 49: | ||
==== LCL3 ==== | ==== LCL3 ==== | ||
This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a | This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. | ||
Sequence for lacI (from BBa_K091121 - wild type lacI): | Sequence for lacI (from BBa_K091121 - wild type lacI): | ||
<blockquote><tt> | <blockquote><tt> | ||
Revision as of 19:18, 12 February 2010
Notes on using the NEB PURExpress system.
Worked example: inducible expression
To illustrate how the system works, I am going to try various combinations of three different constructs:
- PLG1 (BBa_I2035) - GFP with a LacI-repressible promoter on a plasmid
- LLG2 (T7-Plac:RBS:GFP) - linear DNA with GFP on a LacI-repressible promoter, PCR'd from BBa_I2035
- LCL3 (T7:RBS:lacI) - linear lacI on a constitutive T7 promoter
In addition, I may build up an RFP-based construct, just in case I can't get access to BBa_I2035:
- PLR4 (T7-Plac:RBS:RFP) - plasmid DNA with RFP on a LacI-repressible promoter, PCR'd from the purified RFP plasmid (based on plasmids provided by Karsten Temme at UCSF) and inserted into Novagen pET vector. This can be used as a replacement for PLG1, if needed.
Naming scheme:
- L/P - DNA type: linear DNA versus plasmid
- C/L - promoter type: constitutive T7 promoter versus LacI-repressible
- G/L/R - coding region: GFP, RFP or LacI
Using these components, I can try out the following "circuits":
- GFP expression on a lacI-repressible T7 promoter (with no lacI => should flouresence): PLG1 or LLG2
- This will allow a positive control to make sure that a T7 promoter with operator site still works
- Repression of GFP by lacI: PLG1/LLG2 + LCL3
- Induction of GFP using IPTG: PLG1/LLG2 + LCL3
DNA construction
Only the BBa_I2035 plasmid is in the form needed for use with the PURE system. The other sequences will be constructed using PCR-based editing.
PLG1
This construct is part of the biobricks library and will be obtained from freezer stocks at Stanford (e-mail to Drew on 12 Feb confirming existence).
LLG2
This is linear DNA containing a lacI-repressible T7 promoter in front of GFP, extracted from BBa_I2035 using a simple forward and reverse primer. Use of this piece of DNA allows testing of linear DNA versus plasmid DNA.
The sequence for the relevant section of BBa_I2035, starting from the beginning of the promoter and going through the end of the terminator
>BBa_I2035 Part-only sequence (856 bp) tcatacgactcactataggggaattgtgagcggataacaattcccctggatcctactagagtcacacaggaaagtactagatgcgtaaaggagaagaact tttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacgga aaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagat acccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaa gacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaa ttggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatg gaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccct ttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaataataa tactagagctagcataaccccttggggcctctaaacgggtcttgaggggttttttg
- Forward primer: tcatacgactcactataggggaat
- Reverse primer: aaacgggtcttgaggggttttttg
LCL3
This sequence consists of lacI on a constitutive T7-promoter. It is constructed by doing PCR amplification of lacI out of a BBa_K091121 plasmid and then attaching the T7 promoter and RBS using the PURExpress universal primer. Sequence for lacI (from BBa_K091121 - wild type lacI):
>BBa_K091121 Part-only sequence (1083 bp) atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaa cgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgc cacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaa cgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgcca ttgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtac gcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggc tggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctga atgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcgga tatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagc gtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaata cgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtga
- Round 1 forward primer: atgaaaccagtaacgttatacg
- Round 1 reverse primer: atgaaaccagtaacgttatacg
- Round 2 forward primer: PURExpress universal forward primer
- Round 2 reverse primer: same as round 1 reverse primer
PLR4
This is a linear sequence of DNA that can be used as a replacement for LLG2, in case I can't get BBa_I2035. In order to get this sequence, I have to insert RFP into a pET vector (has a lacI-repressible T7 promoter) and grow up some cells.
- Restriction enzymes to be used: TBD (waiting to find out which pET vectors we actually have available)
LCL5
This is a substitute for LCL3 using the Novagen pLacI plasmid (in case I can't get BBa_I2043). The primers are identical to LCL3 since we are just grabbing a standard lacI gene. (Note: need to check there are no modifications to the sequences on the pLacI plasmid; if so, look for another source).