SBB10Ntbk-ZhenZongHuang: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(23 intermediate revisions by the same user not shown)
Line 1: Line 1:
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 12 April 2010 (EST)==
Set up first part of Eco/Bam Transfer and zymol clean up for SSB 24,25,26,31,32, and P9.
10 um for water elution
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 7 April 2010 (EST)==
Project presentations
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 5 April 2010 (EST)==
Worked on Project Presentation
[https://docs.google.com/present/edit?id=0ASA5SNOxZ8G4ZDU2Zzc2ZF8yZzQ3dHg4Y3o&hl=en GoogleDoc Presentation]
Team 3
[ColE2 Ori / Rep System]
-Origin Stability and Copy Number-
---
Andrew Saarni
Kai Mesa
Jose Gutierrez
Zhen Huang
---
[Objective]
-Design assays to...
#Test the orthogonality and stability of regulation for 27 different ColE2 replicons, prepared by combining different Ori/Rep plasmids and promoter regions
#Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori.
[ColE2 Ori / Rep System]
- Description
- ColE2 family of replicons is regulated by two elements:
    - Element 1: ColE2 Origin of Replication
      a.) Located on the plasmid (in cis) (1)
        b.) Minimal required region for Rep binding is 31bp (2)
        c.) 3 subregions: Regions I and II are essential for Rep
             binding; Regions II and III are essential for replication (2)
    - Element 2: Rep(lication) protein 
      a.) Expressed CDS located either in cis or in trans (1)
        b.) Acts also as a plasmid-specific primase; synthesizes    
             3bp RNA primer used for polymerase binding  (2)    
- The presence of these two elements allows the replication of
   the circular plasmid DNA containing the ColE2 Ori. (1)
[ColE2 Ori / Rep System]
- Purpose and Regulation
- Allows implementation of conditionally active genes. (1)
- Transformed plasmid containing ColE2 Ori will remain 
   dormant until transcription of Rep protein is initiated. (1)
- Copy number of the transformed plasmid can therefore be
   increased at will by enabling the ColE2 Ori. (1)
- In the case of the 5'UTR's, a regulatory RNA, which is
   translated along with the rest of the ColE2 Ori in the
   presence of Rep protein, provides negative translational
   feedback by inhibiting translation of Rep protein.
[Our Plasmids]
All assembled parts are vectors with R6K ori
Rep  and Ori (CA42, 099, P9) are in separate plasmids
Using promoters Ptet and Pcon and b1006 terminator
Each plasmid will have a different resistance gene: Rep plasmids are AmpR and KanR, Ori plasmids are SpecR.
R6K ori requires additional gene called pir which encodes the pi protein to be functional and constant expression.
[Origin Stability Assay]
Motivation - Compatibility goups in a nutshell:
Two different plasmid with the same origin of replication in the same cell will compete for replication resources
One solution to the problem is to use two plasmids with different origins.  
In this assay we want to transform cells with different ori/rep pairs out of CA42, 099, P9, and different promoters.
Assay shows where ori/rep pairs fall
equivalent «------------------------------------» orthogonal
(cross-reactive)                           (mutually independent)
[Two Step Transformation]
Problem: Cannot transform both Ori and Rep plasmids at the same time, because if they don't work we will not know if it was because the transformation failed or if parts are in fact orthogonal
Solution: two step transformation process 
#Transform Rep plasmid into Bacteria (Ec100D)
#Plate on (Amp/Kan) plates, Pick Colonies
#Miniprep for plasmid DNA purification
#Analytical digest
#Once first transformation is done, make competent cells    using colony
#Repeat fist four steps with Ori Plasmid, Plate on (Amp/Kan/Spec) plates
 
[Plasmid Copy Number Assay]
Purpose:Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori.
#need a way to standardize relative # of Ori plasmids/cell
#Rep plasid copy should be constant for each cell
#isolate both plasmids, and map
#We can correlate the highest number of Ori plasmids/cell by examining the relative intensities of the two bands
 
[Mapping Protocol]
Miniprep Purification of DNA
Analytical Digests (Mapping)
We will only use EcoR1 in our digests, since we only want to linearize the plasmids. 
Note that the R6K and ori plasmids should be different in size by at least a few hundred base pairs, or it will be difficult to distinguish the plasmid bands on the gel.
[Regulatory Element Efficiency Assay] 
Determine if a band at the ori plasmid size is present 
If a band is present, this will suggest cross-reactivity between the ori/rep combination. And therefore are not orthogonal.
Note that the compliment combination of ori/rep could still be orthogonal.
[Orthogonality Assay]
If an ori plasmid band is detected, measure the relative band intensity, when compared to the correspondent R6K plasmid band.
The R6K plasmid should have a constant expression in all samples that can be used to relate the relative efficiency of each ori/rep combination.
[Different combinations]
For the Origin Stability Assay, our rep composite parts will use ptet and pcon promotors as well as a b1600 terminator
For the Plasmid Copy Number Assay, we will use the rep coding sequence along with its natural regulatory elements
For both assays, we will use the established colE2 replicon ori/rep pairs as positive controls.
All 27 combinations can be found on the Excel File
[References]
1. http://openwetware.org/wiki/Template:SBB10Project-27095
2.  PMID 17098894
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 31 March 2010 (EST)==
Assay Team 3: Origin of Stability and copy number
My group will be characterizing the colE2 origins of replication. One set of experiments is used to determine which combinations of rep protein and ori together confer stable plasmid regulation in cells. In a second set of assays, you will determine the effect of regulatory elements on the plasmids for controlling the copy number of the ori.
Assay 1:
Origin of replication
# SSB 31 CA42
# SSB 32 099
# SSB 39 P9
Rep Protein
# SSB 27 CA42
# SSB 29 099
# SSB 35 P9
Perform transformation on different combination of origin of replication and rep protein to see if they are orthogonal, equivalent, or in between.
Assay 2: Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori. Do mapping and do a measurement of of bands relative to R6K controls.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 10 March 2010 (EST)==
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 8 March 2010 (EST)==
I did mapping for SBB15 and SBB31
I set up the following 10uL reaction in a PCR tube:
#4uL ddH2O
#4uL Miniprepped plasmid
#1uL 10x NEB Buffer 2
#0.5uL EcoRI
#0.5uL BamHI (for parts >250bp SSB31) or XhoI (for parts <250bp SSB15)
#Incubate at 37 on the thermocycler for 30 minutes
#Run an analytical gel
#Take a picture of the gel
#Calculate the expected fragment sizes
#Are the calculated sizes consistent with the bands on the gel?
[http://openwetware.org/wiki/SBB10_gels#Andrew_S SSB15 and SBB31 Mapping]
SSB 31 fragment size is about 2500 and 1000 which is consistent with the expected fragment sizes.
SSB 15 frafment size is about 2000 and 900 which is consistent with the expected fragment sizes.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 3 March 2010 (EST)==
I did miniprep for SBB15 and SBB31
Miniprep purification of DNA
MINIPREP (1mL - 5mL) Procedure for Plasmid DNA Purification
#Pellet around 1.5 mL or 2 mL saturated culture by spinning full speed, 30 seconds.
#Dump supernatant, repeat to pellet another 1.5 mL (for a total of 3 mL)
#Add 250uL of P1 buffer into each tube. Resuspend the cells using a vortexer.
#Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer.
#Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and #leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake.
#Spin in centrifuge at top speed for 5 minutes.
#Label blue columns with an alcohol-resistant lab pen.
#Pour liquid into columns, and place the columns into the centrifuge. Spin at 12000 rpm for 30 seconds.
#Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin)
#Wash each column with 500 uL of PB buffer.
#Spin in centrifuge at 12000rpm for approximately 15 seconds, then flick out the liquid again.
#Wash with 750uL of PE buffer (washes the salts off the resins).
#Spin in centrifuge at 12000rpm for approximately 15 seconds and flick out liquid again.
#Spin in centrifuge at full speed for 1 minute to dry off all water and ethanol.
#Label new tubes and put columns in them.
#Elute them by squirting 50uL of water down the middle of the column (don't let it stick to the sides).
#Spin in centrifuge at top speed for 30 seconds.
#Take out columns and cap the tubes.
#Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature
Put products in box A.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:00, 1 March 2010 (EST)==
I did ligation and transformation for SBB15 and SBB 31.
I set up the following reaction for ligation
#6.5uL ddH2O
#1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
#1uL Vector(pBjk2741) digest
#1uL Insert digest
#0.5uL T4 DNA Ligase
#mix
#incubate on bench for 30 minutes
For transformation by heat shock
Thaw a 200 uL aliquot of cells (JTK086 - double blue stripes)on ice
#Add 50 uL of water to the cells
#Add 30 uL of KCM to the cells
#Put your ligation mixture on ice, let cool a minute or two
#Add 70 uL of the cell cocktail to the ligation, stir to mix
#Let sit on ice for 10 min
#Heat shock for 90 seconds at 42 (longer incubation may work better)
#Put back on ice for 1 min
#Add 100uL of 2YT (same as LB), let shake in the 37 degree incubator for 1 hour
#Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight
I put SSB15 Zymol 2 and SBB31 Zymol gel purification products in Box A.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 14:00, 24 February 2010 (EST)==
EcoRI/BamHI Digest of PCR Products for SBB 31
EcoRI/BamHI Digest of Wobble Products for SBB 15 Did a small Zymol clean up for SBB 15. Product is put into Box A.
I incubate SBB 31 and 15 at 37 degrees on the thermocycler for 1hr. Started at 2:00.
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 13:30, 22 February 2010 (EST)==
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 13:30, 22 February 2010 (EST)==


Line 10: Line 316:
#Sbb15 -- Small Zymol Clean up
#Sbb15 -- Small Zymol Clean up


Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which. Put both pure product in box A.  
Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which.
 
SBB31 and SSB15 are switched. [http://openwetware.org/wiki/SBB10Ntbk-ChrisAnderson gel results].
 
SBB31 and SBB15 are stored in Box B.


==[[User:Zhen Zong Huang|Zhen Z. Huang]] 16:05, 17 February 2010 (EST)==
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 16:05, 17 February 2010 (EST)==
Line 59: Line 369:
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymol Gel Purification]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymol Gel Purification]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Ligation of EcoR1/BamH1 Digest]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Ligation of EcoR1/BamH1 Digest]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Micro1 Transformation]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 Miniprep]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Mapping]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Mapping]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymol Gel Purification]
# squencing


===sbb15===
===sbb15===
Line 66: Line 378:
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo2 Small Zymol Clean up]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo2 Small Zymol Clean up]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz1 EcoR1/BamH1 Digest of Wobble Product]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz1 EcoR1/BamH1 Digest of Wobble Product]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymol Gel Purification]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo2 Small Zymol Clean up]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Ligation of EcoR1/BamH1 Digest]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz4 Ligation of EcoR1/BamH1 Digest]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Micro1 Transformation]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Micro3 Miniprep]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Mapping]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Enz6 Mapping]
# [http://openwetware.org/wiki/Template:SBB-Protocols_Zymo3 Zymol Gel Purification]
# squencing


==[[User:Zhen Zong Huang|Zhen Z. Huang]] 13:00, 18 February 2010 (EST)==
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 13:00, 14 February 2010 (EST)==


==Construction Files for my parts==
==Construction Files for my parts==

Latest revision as of 22:08, 12 April 2010

Zhen Z. Huang 15:00, 12 April 2010 (EST)

Set up first part of Eco/Bam Transfer and zymol clean up for SSB 24,25,26,31,32, and P9.

10 um for water elution

Zhen Z. Huang 15:00, 7 April 2010 (EST)

Project presentations

Zhen Z. Huang 15:00, 5 April 2010 (EST)

Worked on Project Presentation

GoogleDoc Presentation


Team 3

[ColE2 Ori / Rep System]

-Origin Stability and Copy Number- --- Andrew Saarni Kai Mesa Jose Gutierrez Zhen Huang --- [Objective]

-Design assays to...

  1. Test the orthogonality and stability of regulation for 27 different ColE2 replicons, prepared by combining different Ori/Rep plasmids and promoter regions
  1. Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori.

[ColE2 Ori / Rep System]

- Description

- ColE2 family of replicons is regulated by two elements:

    - Element 1: ColE2 Origin of Replication

      a.) Located on the plasmid (in cis) (1)

        b.) Minimal required region for Rep binding is 31bp (2)

        c.) 3 subregions: Regions I and II are essential for Rep

             binding; Regions II and III are essential for replication (2)

    - Element 2: Rep(lication) protein 

      a.) Expressed CDS located either in cis or in trans (1)

        b.) Acts also as a plasmid-specific primase; synthesizes    

             3bp RNA primer used for polymerase binding  (2)    

- The presence of these two elements allows the replication of

   the circular plasmid DNA containing the ColE2 Ori. (1)


[ColE2 Ori / Rep System]

- Purpose and Regulation

- Allows implementation of conditionally active genes. (1)

- Transformed plasmid containing ColE2 Ori will remain 

   dormant until transcription of Rep protein is initiated. (1)

- Copy number of the transformed plasmid can therefore be

   increased at will by enabling the ColE2 Ori. (1)

- In the case of the 5'UTR's, a regulatory RNA, which is

   translated along with the rest of the ColE2 Ori in the

   presence of Rep protein, provides negative translational

   feedback by inhibiting translation of Rep protein.


[Our Plasmids]

All assembled parts are vectors with R6K ori

Rep  and Ori (CA42, 099, P9) are in separate plasmids

Using promoters Ptet and Pcon and b1006 terminator

Each plasmid will have a different resistance gene: Rep plasmids are AmpR and KanR, Ori plasmids are SpecR.

R6K ori requires additional gene called pir which encodes the pi protein to be functional and constant expression.


[Origin Stability Assay]

Motivation - Compatibility goups in a nutshell:

Two different plasmid with the same origin of replication in the same cell will compete for replication resources

One solution to the problem is to use two plasmids with different origins.  

In this assay we want to transform cells with different ori/rep pairs out of CA42, 099, P9, and different promoters.

Assay shows where ori/rep pairs fall

equivalent «------------------------------------» orthogonal

(cross-reactive)                           (mutually independent)


[Two Step Transformation]

Problem: Cannot transform both Ori and Rep plasmids at the same time, because if they don't work we will not know if it was because the transformation failed or if parts are in fact orthogonal

Solution: two step transformation process 

  1. Transform Rep plasmid into Bacteria (Ec100D)
  1. Plate on (Amp/Kan) plates, Pick Colonies
  1. Miniprep for plasmid DNA purification
  1. Analytical digest
  1. Once first transformation is done, make competent cells    using colony
  1. Repeat fist four steps with Ori Plasmid, Plate on (Amp/Kan/Spec) plates

 



[Plasmid Copy Number Assay]

Purpose:Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori.

  1. need a way to standardize relative # of Ori plasmids/cell
  1. Rep plasid copy should be constant for each cell
  1. isolate both plasmids, and map
  1. We can correlate the highest number of Ori plasmids/cell by examining the relative intensities of the two bands

 

[Mapping Protocol]

Miniprep Purification of DNA

Analytical Digests (Mapping)

We will only use EcoR1 in our digests, since we only want to linearize the plasmids. 

Note that the R6K and ori plasmids should be different in size by at least a few hundred base pairs, or it will be difficult to distinguish the plasmid bands on the gel.


[Regulatory Element Efficiency Assay] 

Determine if a band at the ori plasmid size is present 

If a band is present, this will suggest cross-reactivity between the ori/rep combination. And therefore are not orthogonal.

Note that the compliment combination of ori/rep could still be orthogonal.


[Orthogonality Assay]

If an ori plasmid band is detected, measure the relative band intensity, when compared to the correspondent R6K plasmid band.

The R6K plasmid should have a constant expression in all samples that can be used to relate the relative efficiency of each ori/rep combination.


[Different combinations]

For the Origin Stability Assay, our rep composite parts will use ptet and pcon promotors as well as a b1600 terminator

For the Plasmid Copy Number Assay, we will use the rep coding sequence along with its natural regulatory elements

For both assays, we will use the established colE2 replicon ori/rep pairs as positive controls.

All 27 combinations can be found on the Excel File


[References]

1. http://openwetware.org/wiki/Template:SBB10Project-27095

2.  PMID 17098894


Zhen Z. Huang 15:00, 31 March 2010 (EST)

Assay Team 3: Origin of Stability and copy number

My group will be characterizing the colE2 origins of replication. One set of experiments is used to determine which combinations of rep protein and ori together confer stable plasmid regulation in cells. In a second set of assays, you will determine the effect of regulatory elements on the plasmids for controlling the copy number of the ori.

Assay 1:

Origin of replication

  1. SSB 31 CA42
  2. SSB 32 099
  3. SSB 39 P9

Rep Protein

  1. SSB 27 CA42
  2. SSB 29 099
  3. SSB 35 P9

Perform transformation on different combination of origin of replication and rep protein to see if they are orthogonal, equivalent, or in between.

Assay 2: Determine the effect of regulatory elements on each plasmid with regard to controlling the copy number of the ColE2 Ori. Do mapping and do a measurement of of bands relative to R6K controls.


Zhen Z. Huang 15:00, 10 March 2010 (EST)

Zhen Z. Huang 15:00, 8 March 2010 (EST)

I did mapping for SBB15 and SBB31 I set up the following 10uL reaction in a PCR tube:

  1. 4uL ddH2O
  2. 4uL Miniprepped plasmid
  3. 1uL 10x NEB Buffer 2
  4. 0.5uL EcoRI
  5. 0.5uL BamHI (for parts >250bp SSB31) or XhoI (for parts <250bp SSB15)
  6. Incubate at 37 on the thermocycler for 30 minutes
  7. Run an analytical gel
  8. Take a picture of the gel
  9. Calculate the expected fragment sizes
  10. Are the calculated sizes consistent with the bands on the gel?

SSB15 and SBB31 Mapping

SSB 31 fragment size is about 2500 and 1000 which is consistent with the expected fragment sizes. SSB 15 frafment size is about 2000 and 900 which is consistent with the expected fragment sizes.

Zhen Z. Huang 15:00, 3 March 2010 (EST)

I did miniprep for SBB15 and SBB31

Miniprep purification of DNA MINIPREP (1mL - 5mL) Procedure for Plasmid DNA Purification

  1. Pellet around 1.5 mL or 2 mL saturated culture by spinning full speed, 30 seconds.
  2. Dump supernatant, repeat to pellet another 1.5 mL (for a total of 3 mL)
  3. Add 250uL of P1 buffer into each tube. Resuspend the cells using a vortexer.
  4. Add 250uL of P2 buffer (a base that denatures everything and causes cells to lyse). Gently mix up and down. Solution should become clearer.
  5. Add 350uL of N3 buffer (an acid of pH ~5 that causes cell junk - including protein and chromosomal DNA - to precipitate, and #leaves plasmids and other small molecules in solution). Slowly invert a few times, then shake.
  6. Spin in centrifuge at top speed for 5 minutes.
  7. Label blue columns with an alcohol-resistant lab pen.
  8. Pour liquid into columns, and place the columns into the centrifuge. Spin at 12000 rpm for 30 seconds.
  9. Dump liquid out of the collectors under the columns (the DNA should be stuck to the white resin)
  10. Wash each column with 500 uL of PB buffer.
  11. Spin in centrifuge at 12000rpm for approximately 15 seconds, then flick out the liquid again.
  12. Wash with 750uL of PE buffer (washes the salts off the resins).
  13. Spin in centrifuge at 12000rpm for approximately 15 seconds and flick out liquid again.
  14. Spin in centrifuge at full speed for 1 minute to dry off all water and ethanol.
  15. Label new tubes and put columns in them.
  16. Elute them by squirting 50uL of water down the middle of the column (don't let it stick to the sides).
  17. Spin in centrifuge at top speed for 30 seconds.
  18. Take out columns and cap the tubes.
  19. Clean up - note the P1 buffer is stored at 4degC and all the rest at room temperature

Put products in box A.

Zhen Z. Huang 15:00, 1 March 2010 (EST)

I did ligation and transformation for SBB15 and SBB 31.

I set up the following reaction for ligation

  1. 6.5uL ddH2O
  2. 1uL T4 DNA Ligase Buffer (small red or black-striped tubes)
  3. 1uL Vector(pBjk2741) digest
  4. 1uL Insert digest
  5. 0.5uL T4 DNA Ligase
  6. mix
  7. incubate on bench for 30 minutes

For transformation by heat shock Thaw a 200 uL aliquot of cells (JTK086 - double blue stripes)on ice

  1. Add 50 uL of water to the cells
  2. Add 30 uL of KCM to the cells
  3. Put your ligation mixture on ice, let cool a minute or two
  4. Add 70 uL of the cell cocktail to the ligation, stir to mix
  5. Let sit on ice for 10 min
  6. Heat shock for 90 seconds at 42 (longer incubation may work better)
  7. Put back on ice for 1 min
  8. Add 100uL of 2YT (same as LB), let shake in the 37 degree incubator for 1 hour
  9. Plate 70+ uL on selective antibiotics, let incubate at 37 degrees overnight

I put SSB15 Zymol 2 and SBB31 Zymol gel purification products in Box A.


Zhen Z. Huang 14:00, 24 February 2010 (EST)

EcoRI/BamHI Digest of PCR Products for SBB 31

EcoRI/BamHI Digest of Wobble Products for SBB 15 Did a small Zymol clean up for SBB 15. Product is put into Box A.

I incubate SBB 31 and 15 at 37 degrees on the thermocycler for 1hr. Started at 2:00.

Zhen Z. Huang 13:30, 22 February 2010 (EST)

I prepared analytical gel for sbb31.

Analytical gel for SBB31

It looks like about 500 bps. The expected product is 547 bp. This looks like the right product.

  1. Sbb31 -- Zymol Clean up
  2. Sbb15 -- Small Zymol Clean up

Because I forgot to label the tubes, I do not know which one is SBB15 and which one is SBB31. Need to run gel to figure out which one is which.

SBB31 and SSB15 are switched. gel results.

SBB31 and SBB15 are stored in Box B.

Zhen Z. Huang 16:05, 17 February 2010 (EST)

Wed, Feb 17th, 2010

I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.

sbb31

Regular PCR

I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.

I added the following into a PCR tube in the following order:

  1. 24uL ddH2O
  2. 3.3uL 10x Expand Buffer "2"
  3. 3.3uL dNTPs (2mM in each)
  4. 1uL Oligo 1, 10uM
  5. 1uL Oligo 2, 10uM
  6. 0.5uL Expand polymerase "1"
  7. 0.5uL Template DNA

I put the the PCR tube in the 2K55 ice bucket.

sbb15

Wobble

I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20

I added the following into a PCR tube in the following order:

  1. 29 uL water
  2. 5 uL Expand 10x Buffer 2
  3. 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
  4. 5 uL Oligo 1 (100uM)
  5. 5 uL Oligo 2 (100uM)
  6. 0.75 uL Expand Polymerase 1

I put the resulting wobble PCR tube in the 2k55 ice bucket.

Zhen Z. Huang 15:05, 16 February 2010 (EST)

Planning for Wed, Feb 17th, 2010

sbb31

  1. PCR
  2. Analytical gel
  3. Regular Zymol Clean up
  4. EcoR1/BamH1 Digest of PCR Product
  5. Zymol Gel Purification
  6. Ligation of EcoR1/BamH1 Digest
  7. Transformation
  8. Miniprep
  9. Mapping
  10. squencing

sbb15

  1. Wobble
  2. Small Zymol Clean up
  3. EcoR1/BamH1 Digest of Wobble Product
  4. Small Zymol Clean up
  5. Ligation of EcoR1/BamH1 Digest
  6. Transformation
  7. Miniprep
  8. Mapping
  9. squencing

Zhen Z. Huang 13:00, 14 February 2010 (EST)

Construction Files for my parts

sbb31

sbb31: CA42 origin of replication
Source:  pEC22-CA42
Target Sequence:  agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg
Vector:  pBjk2741
Short description: oriCA42
Genbank reference: D30056.1 
Family:  Origin of Replication

PCR ZZH001 and ZZH002 on pEC22-CA42  (547 bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144             (EcoRI/BamHI, 2472+910, L)
Product is pBca9523-sbb31         {oriCA42}
----------------------------
ZZH001   Forward oligo for cloning of oriCA42   
ccataGAATTCatgAGATCTagcacttcagcgcgccgtag
ZZh002   Reverse oligo for cloning of oriCA42    
ctgatGGATCCcggcaaaagacctactgctc


sbb15

sbb15: phiC31 attB
Source:  Synthetic
Target Sequence:  tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca
Vector:  pBjk2741
Short descriptions: phiC31 attB
Genbank reference: AB306970 (759…842) 
Family:  Phage att site

good 20 bp gtgccagggcgtgcccttgg

Wobble ZZH003/ZZH004            (115bp, EcoRI/BamHI)
Sub into pBjk2741-Bca1144         (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sbb15     {phiC31 attB}
----
ZZH003   Forward construction of phiC31 attB basic part
ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg
ZZH004   Reverse construction of phiC31 attB basic part
ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac