Stanford/BIOE44:Module3:Day2:nitrate: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
← Older editNewer edit →
No edit summary
No edit summary
Line 10: Line 10:
Novel Bio Bricks Part:  Bba_NRL001
Novel Bio Bricks Part:  Bba_NRL001


'''Long Description:'''  To develop a functional nitrate sensor, our group is attempting to couple the two-component Nar pathway to an RFP reporter to observe RFP expression in response to different concentrations of nitrate.  Because our sensor needs to be able to detect nitrate levels of 10 ppm (the MCL designated by the EPA), our group decided to create a part containing the NarL coding sequence.  We plan on inserting the NarL cds downstream of a RBS and constitutive promoter in order to potentially enhance the signal of RFP expression in response to nitrate activation of the two-component pathway.  Nitrate detection levels based on data by Edinburgh iGEM team 2009 [http://partsregistry.org/Part:BBa_K216005:Experience]
'''Long Description:'''  The NarL protein is a cytoplasmic transcription factor that serves as the second component in the two-component Nar pathway found in ''E. Coli'' K-12.  When NarX (a membrane protein) binds nitrate, it autophosphorylates and then acts as a histidine kinase on the NarL protein.  When NarL is phosphorylated, it binds bacterial DNA and acts as a repressor/activator, depending on the particular operon.   


'''Short Description:'''  Coding sequence for NarL protein in accordance with BioBrick assembly 10 standards
'''Short Description:'''  Coding sequence for the NarL protein, a response regulator in Nar pathway, in accordance with BioBrick assembly 10.


'''Sequence:'''
'''Sequence:'''
Line 25: Line 25:


'''Stewart, V., R. S. Rabin'''  1993.  Dual Response Regulators (NarL and NarP) Interact with Dual Sensors (NarX and NarQ) To Control Nitrate - and Nitrite - Regulated Gene Expression in ''Escherichia coli'' K-12.  J. Bacteriol.  '''175:''' 3259 - 3268
'''Stewart, V., R. S. Rabin'''  1993.  Dual Response Regulators (NarL and NarP) Interact with Dual Sensors (NarX and NarQ) To Control Nitrate - and Nitrite - Regulated Gene Expression in ''Escherichia coli'' K-12.  J. Bacteriol.  '''175:''' 3259 - 3268
'''Sequence Information'''
Link to [http://www.ncbi.nlm.nih.gov/gene/945795 NarL Sequence Information]

Revision as of 22:11, 4 May 2010

Home        People        Schedule        Key Info.        OWW Basics       
DNA Engineering        Devices        Synthesis        Baking        Testing

STATUS

Loaded up at DNA2.0 and authors have confirmed sequence is correct. Good to order!

Nitrate Sensor Project

Authors: Scott Runyon and Travis Urban

Novel Bio Bricks Part: Bba_NRL001

Long Description: The NarL protein is a cytoplasmic transcription factor that serves as the second component in the two-component Nar pathway found in E. Coli K-12. When NarX (a membrane protein) binds nitrate, it autophosphorylates and then acts as a histidine kinase on the NarL protein. When NarL is phosphorylated, it binds bacterial DNA and acts as a repressor/activator, depending on the particular operon.

Short Description: Coding sequence for the NarL protein, a response regulator in Nar pathway, in accordance with BioBrick assembly 10.

Sequence:

gaattcgcggccgcttctagATGAGTAATCAGGAACCGGCTACTATCCTGCTGATTGACGATCACCCGATGCTGCGAACTGGCGTAAAACAGCTTATCAGTATGGCACCAGATATCACCGTGGTTGGCGAAGCGAGTAATGGCGAACAGGGTATTGAACT GGCGGAGTCTCTTGATCCCGATCTGATCCTGTTAGATCTCAATATGCCCGGCATGAACGGTCTGGAAACG CTGGATAAACTGCGCGAAAAGTCCCTCTCAGGGCGCATTGTGGTATTCAGCGTCTCTAACCATGAAGAAG ATGTGGTCACCGCACTGAAACGCGGCGCGGATGGCTATCTGTTAAAAGATATGGAACCGGAAGATCTGCT GAAAGCATTGCATCAGGCAGCTGCTGGCGAAATGGTATTAAGCGAAGCATTAACGCCTGTTCTGGCCGCC AGCTTGCGCGCTAACCGTGCCACTACTGAGCGCGATGTTAACCAGTTAACCCCACGCGAGCGCGATATTC TCAAGCTGATTGCCCAGGGTTTGCCGAACAAGATGATTGCCCGCCGCCTGGATATCACCGAAAGCACAGT AAAAGTGCACGTCAAGCACATGCTGAAGAAAATGAAGCTCAAGTCTCGCGTGGAAGCAGCGGTATGGGTG CATCAGGAGCGCATTTTCTAAtactagtagcggccgctgcag

Natural NarL sequence did not contain any EcoRI, PstI, SpeI, or XbaI restriction sites. NarL part is therefore usable by BioBrick Assmebly 10 standards.

References:

Stewart, V., H. Lin, P. Bledsoe. 2007. Activation of yeaR-yoaG Operon Transcription by the Nitrate-Responsive Regulator NarL Is Independent of Oxygen-Responsive Regulator Fnr in Escherichia coli K-12. J. Bacteriol. 189: 7539 - 7548

Stewart, V., R. S. Rabin 1993. Dual Response Regulators (NarL and NarP) Interact with Dual Sensors (NarX and NarQ) To Control Nitrate - and Nitrite - Regulated Gene Expression in Escherichia coli K-12. J. Bacteriol. 175: 3259 - 3268

Sequence Information

Link to NarL Sequence Information

Retrieved from "https://openwetware.org/mediawiki/index.php?title=Stanford/BIOE44:Module3:Day2:nitrate&oldid=412412"