|
|
| (19 intermediate revisions by the same user not shown) |
| Line 1: |
Line 1: |
| Hello, Hossein Azari Soufiani! This is a welcome message from OpenWetWare. By the way, we've announced you on the [[Main Page|home page]]! You can leave messages to any OWW member by editing their User_talk pages like this one. And don't forget to personalize your [[User:Hossein Azari Soufiani|User Page]] so that we can get to know you better! We've included some tips below to get you started.
| |
|
| |
| ==Some Initial Ideas for Course Project==
| |
| I have two initial ideas to think about:
| |
|
| |
| The First one is related to engineering of cell and I am putting a brief introduction of that:
| |
|
| |
| A cell action is a complex combination of many chemical actions. The best way to analyze these networks and manipulate them to change their action to what we like. Which deals with optimization methods and key idea for this approach have been build based on consideration that cells or bacterias naturally optimize growth which it is not generally correct.
| |
|
| |
| Since we can categorize this project as a mathematical modeling it should be an iterative research between understanding nonlinear nature of cellular actions and make the model better and better.
| |
|
| |
|
| |
| Second one is:
| |
|
| |
| I may be totally wrong but I want to try and understand the information structure in the evolutionary path of the world.
| |
|
| |
|
| |
| I will write more...
| |
|
| |
| == Report of Second Homework == | | == Report of Second Homework == |
|
| |
|
| The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting for me because I am an engineer and I like to see the problems from engineering point of view. | | The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting. |
| The paper was written in a very classic engineering manner and it made understanding of our position in Bioengineering more clear for me.
| |
| | |
| Installing and preparing Python was very different than the other programs which I used before like Matlab, C++.
| |
| I enjoyed using it, specially the object oriented programing ability makes it really powerful.
| |
| Plot for Python is very similar to Matlab and we have same commands with a little bit difference.
| |
| Here you see a plot for three different growth rates for exponential function plotted with different colors.
| |
| | |
| [[Image:plot1.jpg]]
| |
| | |
| ==Code for Third Homework==
| |
| import random
| |
| import numpy as np
| |
| | |
| print
| |
| print
| |
| | |
| Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc
| |
| tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc
| |
| cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc
| |
| aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc
| |
| aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc
| |
| gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat
| |
| tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac
| |
| ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct
| |
| ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga
| |
| tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact
| |
| ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg'
| |
| RCCode=Code
| |
| TempCode=Code
| |
| | |
| print 'Code=',Code
| |
| print
| |
| print
| |
| | |
| | |
| pro1=range(1,339)
| |
| pro2=range(1,339)
| |
| pro3=range(1,339)
| |
| prom1=range(1,339)
| |
| prom2=range(1,339)
| |
| prom3=range(1,339)
| |
| | |
| #----------------------Problem one --------------------------------------------
| |
| | |
| | |
| GCcontent=0
| |
| for i in range(0,len(Code)-1):
| |
| | |
| if Code[i]=='c':
| |
| GCcontent=GCcontent+1
| |
| elif Code[i]=='g':
| |
| GCcontent=GCcontent+1
| |
| | |
| | |
| | |
| | |
| print 'GC Content=',GCcontent
| |
| print
| |
| print
| |
| print
| |
| print
| |
| #----------------------Problem two---------------------------------------------
| |
| | |
| for i in range(0,len(Code)-1):
| |
| | |
| if Code[len(Code)-1-i]=='c':
| |
| RCCode=RCCode[:i]+'g'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='g':
| |
| RCCode=RCCode[:i]+'c'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='t':
| |
| RCCode=RCCode[:i]+'a'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='a':
| |
| RCCode=RCCode[:i]+'t'+RCCode[i+1:]
| |
| | |
| print 'Recerse Complement=:', RCCode
| |
| print
| |
| print
| |
| #----------------------Problem Three---------------------------------------------
| |
| Here we put the table That I didn't put because it doesn't look good!!!
| |
| | |
| for i in range(0,338):
| |
| | |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
| | |
| pro1[i]=standard[Temp1]
| |
| pro2[i]=standard[Temp2]
| |
| pro3[i]=standard[Temp3]
| |
| | |
| Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2]
| |
| Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3]
| |
| Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
| |
| | |
| prom1[i]=standard[Temp1]
| |
| prom2[i]=standard[Temp2]
| |
| prom3[i]=standard[Temp3]
| |
| | |
| | |
| | |
| print 'Sequence of (+1) frame'
| |
| print pro1
| |
| | |
| print 'Sequence of (+2) frame'
| |
| print pro2
| |
| | |
| print 'Sequence of (+3) frame'
| |
| print pro3
| |
| | |
| print 'Sequence of (-1) frame'
| |
| print prom1
| |
| | |
| print 'Sequence of (-2) frame'
| |
| print prom2
| |
| | |
| print 'Sequence of (-3) frame'
| |
| print prom3
| |
| | |
| | |
| #-----------------------------Problem Four---------------------------
| |
| | |
| counter=0
| |
| for j in range(0,1000):
| |
| | |
| Code=TempCode
| |
| for i in range(0,10):
| |
| | |
| Te=random.random()
| |
| Te=np.fix(100*Te)
| |
| Te2=random.random()
| |
| Te2=int(np.fix(10*Te2))%3
| |
|
| |
|
| |
| | |
|
| |
|
| |
| if (Code[100*i+int(Te)]=='c') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
| | |
| | |
| | |
| | |
| elif (Code[100*i+int(Te)]=='a') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
| | |
|
| |
| | |
| | |
| | |
| pro21=range(1,339)
| |
| pro22=range(1,339)
| |
| pro23=range(1,339)
| |
| | |
| | |
| | |
| | |
| for i in range(0,338):
| |
| | |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
| | |
| pro21[i]=standard[Temp1]
| |
| pro22[i]=standard[Temp2]
| |
| pro23[i]=standard[Temp3]
| |
| | |
|
| |
| for i in range(0,len(pro21)-1):
| |
| | |
| if pro21[i]=='*' and pro1[i]!='*':
| |
| counter=counter+1
| |
|
| |
| | |
| print 'Percent of Premature Termination=',counter,'/1000'
| |
| print
| |
| print
| |
| | |
| print 'Before Mutation:', pro1
| |
| print
| |
| print
| |
| | |
| print 'After Mutation:', pro21
| |
| | |
| input()
| |
| | |
| == Personal/Lab Info ==
| |
| We have gone ahead and filled in some information you provided us in your membership application on your [[User:Hossein Azari Soufiani|User Page]]. Please take a moment to embellish this and tell the community a little more about you. Put links to your lab pages, your projects and your interests. If you run out of ideas, take a look at some of the other User pages. For example, check out [[User:Julius_B._Lucks]], [[User:Jason_R._Kelly]] and [[User:Reshma_P._Shetty]].
| |
| | |
| You'll also notice that we have put an 'image' placeholder at the top of your [[User:Hossein Azari Soufiani|User Page]]. We encourage you to upload an image of yourself to give OWW a more personal feel. To upload an image, click on the [[Special:Upload|Upload file]] link on the left-hand side (toolbar). Choose a file from your computer, and remember the file name. After you have uploaded the image, you should see it loaded on its own page. Go back to your [[User:Hossein Azari Soufiani|User Page]], click on edit, and replace 'OWWEmblem.png' with the name of your file that you have uploaded in the second line of this page.
| |