|
|
| (One intermediate revision by the same user not shown) |
| Line 2: |
Line 2: |
|
| |
|
| The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting. | | The paper [[Media:Endy2005.pdf|"Foundations for the Engineering Biology"]] was really interesting. |
|
| |
| ==Code for Third Homework==
| |
| import random
| |
| import numpy as np
| |
|
| |
| print
| |
| print
| |
|
| |
| Code='cggagcagctcactattcacccgatgagaggggaggagagagagagaaaatgtcctttaggccggttcctcttacttggcagagggaggc
| |
| tgctattctccgcctgcatttctttttctggattacttagttatggcctttgcaaaggcaggggtatttgttttgatgcaaacctcaatccctccc
| |
| cttctttgaatggtgtgccccaccccccgggtcgcctgcaacctaggcggacgctaccatggcgtagacagggagggaaagaagtgtgcagaaggc
| |
| aagcccggaggcactttcaagaatgagcatatctcatcttcccggagaaaaaaaaaaaagaatggtacgtctgagaatgaaattttgaaagagtgc
| |
| aatgatgggtcgtttgataatttgtcgggaaaaacaatctacctgttatctagctttgggctaggccattccagttccagacgcaggctgaacgtc
| |
| gtgaagcggaaggggcgggcccgcaggcgtccgtgtggtcctccgtgcagccctcggcccgagccggttcttcctggtaggaggcggaactcgaat
| |
| tcatttctcccgctgccccatctcttagctcgcggttgtttcattccgcagtttcttcccatgcacctgccgcgtaccggccactttgtgccgtac
| |
| ttacgtcatctttttcctaaatcgaggtggcatttacacacagcgccagtgcacacagcaagtgcacaggaagatgagttttggcccctaaccgct
| |
| ccgtgatgcctaccaagtcacagacccttttcatcgtcccagaaacgtttcatcacgtctcttcccagtcgattcccgaccccacctttattttga
| |
| tctccataaccattttgcctgttggagaacttcatatagaatggaatcaggatgggcgctgtggctcacgcctgcactttggctcacgcctgcact
| |
| ttgggaggccgaggcgggcggattacttgaggataggagttccagaccagcgtggccaacgtggtg'
| |
| RCCode=Code
| |
| TempCode=Code
| |
|
| |
| print 'Code=',Code
| |
| print
| |
| print
| |
|
| |
|
| |
| pro1=range(1,339)
| |
| pro2=range(1,339)
| |
| pro3=range(1,339)
| |
| prom1=range(1,339)
| |
| prom2=range(1,339)
| |
| prom3=range(1,339)
| |
|
| |
| #----------------------Problem one --------------------------------------------
| |
|
| |
|
| |
| GCcontent=0
| |
| for i in range(0,len(Code)-1):
| |
|
| |
| if Code[i]=='c':
| |
| GCcontent=GCcontent+1
| |
| elif Code[i]=='g':
| |
| GCcontent=GCcontent+1
| |
|
| |
|
| |
|
| |
|
| |
| print 'GC Content=',GCcontent
| |
| print
| |
| print
| |
| print
| |
| print
| |
| #----------------------Problem two---------------------------------------------
| |
|
| |
| for i in range(0,len(Code)-1):
| |
|
| |
| if Code[len(Code)-1-i]=='c':
| |
| RCCode=RCCode[:i]+'g'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='g':
| |
| RCCode=RCCode[:i]+'c'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='t':
| |
| RCCode=RCCode[:i]+'a'+RCCode[i+1:]
| |
| if Code[len(Code)-1-i]=='a':
| |
| RCCode=RCCode[:i]+'t'+RCCode[i+1:]
| |
|
| |
| print 'Recerse Complement=:', RCCode
| |
| print
| |
| print
| |
| #----------------------Problem Three---------------------------------------------
| |
| Here we put the table That I didn't put because it doesn't look good!!!
| |
|
| |
| for i in range(0,338):
| |
|
| |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
|
| |
| pro1[i]=standard[Temp1]
| |
| pro2[i]=standard[Temp2]
| |
| pro3[i]=standard[Temp3]
| |
|
| |
| Temp1=RCCode[3*i]+RCCode[3*i+1]+RCCode[3*i+2]
| |
| Temp2=RCCode[3*i+1]+RCCode[3*i+2]+RCCode[3*i+3]
| |
| Temp3=RCCode[3*i+2]+RCCode[3*i+3]+RCCode[3*i+4]
| |
|
| |
| prom1[i]=standard[Temp1]
| |
| prom2[i]=standard[Temp2]
| |
| prom3[i]=standard[Temp3]
| |
|
| |
|
| |
|
| |
| print 'Sequence of (+1) frame'
| |
| print pro1
| |
|
| |
| print 'Sequence of (+2) frame'
| |
| print pro2
| |
|
| |
| print 'Sequence of (+3) frame'
| |
| print pro3
| |
|
| |
| print 'Sequence of (-1) frame'
| |
| print prom1
| |
|
| |
| print 'Sequence of (-2) frame'
| |
| print prom2
| |
|
| |
| print 'Sequence of (-3) frame'
| |
| print prom3
| |
|
| |
|
| |
| #-----------------------------Problem Four---------------------------
| |
|
| |
| counter=0
| |
| for j in range(0,1000):
| |
|
| |
| Code=TempCode
| |
| for i in range(0,10):
| |
|
| |
| Te=random.random()
| |
| Te=np.fix(100*Te)
| |
| Te2=random.random()
| |
| Te2=int(np.fix(10*Te2))%3
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| if (Code[100*i+int(Te)]=='c') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='c') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='t') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='g') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'a'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==1):
| |
| Code=Code[:100*i+int(Te)]+'g'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==2):
| |
| Code=Code[:100*i+int(Te)]+'t'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
| elif (Code[100*i+int(Te)]=='a') and (Te2==0):
| |
| Code=Code[:100*i+int(Te)]+'c'+Code[100*i+int(Te)+1:]
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| pro21=range(1,339)
| |
| pro22=range(1,339)
| |
| pro23=range(1,339)
| |
|
| |
|
| |
|
| |
|
| |
| for i in range(0,338):
| |
|
| |
| Temp1=Code[3*i]+Code[3*i+1]+Code[3*i+2]
| |
| Temp2=Code[3*i+1]+Code[3*i+2]+Code[3*i+3]
| |
| Temp3=Code[3*i+2]+Code[3*i+3]+Code[3*i+4]
| |
|
| |
| pro21[i]=standard[Temp1]
| |
| pro22[i]=standard[Temp2]
| |
| pro23[i]=standard[Temp3]
| |
|
| |
|
| |
| for i in range(0,len(pro21)-1):
| |
|
| |
| if pro21[i]=='*' and pro1[i]!='*':
| |
| counter=counter+1
| |
|
| |
|
| |
| print 'Percent of Premature Termination=',counter,'/1000'
| |
| print
| |
| print
| |
|
| |
| print 'Before Mutation:', pro1
| |
| print
| |
| print
| |
|
| |
| print 'After Mutation:', pro21
| |
|
| |
| input()
| |
|
| |
|
| |
|
| |
|
| |
|
| |
|
| |
|
| |
| ==December report for project ==
| |
|
| |
| During this project we started from looking at the dogma of biological systems and we tried to discus on the evolutionary development.
| |
|
| |
| After dividing into groups we as mathematical modeling started to look at a model which encompass the evolutionary notion of development in it.
| |
| Basically it uses Control theory ideas to design a system which will use a feedback system which optimally will use the experiment results as much as possible.
| |
|
| |
| After proposing our system and having discussion in the class we went forward to an numerical example.
| |
| After discussions with biology group and infrastructure we got two examples as eye-color and height.
| |
|
| |
| So far we are working on the logistic modeling and we will use this method on the results that infrastructure part will give us from online resources.
| |
|
| |
| Details of our group discussion is on the wiki.
| |
|
| |
| This was a very good initiative for bio processing for me and the way we started to understand the details of this evolving path and start to think together to overcome the problems.
| |
|
| |
| Thanks George a lot for shedding light in this way for us and thanks Harris and Sasha for their helps.
| |
|
| |
| With all the best,
| |
| Hossein
| |
