Prbbbb:vector pcr: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
New page: ==Overview== PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies. ==Materials== *100 ul + PCR tubes *Phusion HotStart Po... |
|||
| (44 intermediate revisions by the same user not shown) | |||
| Line 1: | Line 1: | ||
[[PrbbBB:Protocols| Back to all protocols]] | |||
==Overview== | ==Overview== | ||
PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies. | A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies. | ||
The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection. | |||
==Materials== | ==Materials== | ||
*100 ul + PCR tubes | *100 ul + PCR tubes | ||
*Phusion HotStart Polymerase 2 U/ul | *[[Phusion]] HotStart Polymerase 2 U/ul | ||
*Phusion HF Buffer 5x | *Phusion HF Buffer 5x | ||
*dNTP mix 10mM each nucleotide | *dNTP mix 10mM each nucleotide | ||
*ddH2O | *ddH2O | ||
*reverse prefix primer rg0301 ( | *reverse prefix primer [http://brickit.crg.es/registry/biobrick/190/ rg0301 (CRG)] -- [http://partsregistry.org/Part:BBa_J18910 -- BBa_J18910] (RFC 25 format, ACCGGTTAATACTAGTAGCGGCC) | ||
*reverse suffix primer rg0302 ( | *reverse suffix primer [http://brickit.crg.es/registry/biobrick/191/ rg0302 (CRG)] -- [http://partsregistry.org/Part:BBa_J18911 BBa_J18911](RFC 25 format, GCCGGCCATCTAGAAGCG) | ||
*vector template DNA | *vector template DNA | ||
**pSB1AC3F -- BBa_J18901 | **[http://brickit.crg.es/registry/vector/11/ pSB1AC3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18901] | ||
**pSB1AK3F -- BBa_J18902 | **[http://brickit.crg.es/registry/vector/12/ pSB1AK3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18902] | ||
**pSB1AT3F -- BBa_J18903 | **[http://brickit.crg.es/registry/vector/13/ pSB1AT3F (CRG)] -- [http://partsregistry.org/Part:BBa_J18901 BBa_J18903] | ||
* [[DpnI]] restriction enzyme | |||
* [[Antarctic Phosphatase]] and 10 x buffer | |||
==Procedure== | ==Procedure== | ||
<table frame=box> | '''setup PCR reaction''' | ||
<tr align= | |||
<td | <table frame=box> | ||
<tr align=right> | |||
<td></td> <th width=100>µl, single reaction</th> <th width=100>3.5xMaster</th> <th width=100>10xMaster</th></tr> | |||
<tr align=right> <td>H2O</td> <td>76µl</td> <td>266</td> <td>760</td> </tr> | |||
<tr align=right> <td>5x HF Buffer</td> <td>20µl</td> <td>70</td> <td>200</td> </tr> | |||
<tr align=right> <td>10mM dNTP</td> <td>2µl</td> <td>7</td> <td>20</td> </tr> | |||
<tr><td></td></tr> | |||
<tr align=right> <td>rg0301 100 µM</td> <td>0.5µl</td> <td>1.75</td> <td>5</td> </tr> | |||
<tr align=right> <td>rg0302 100 µM</td> <td>0.5µl</td> <td>1.75</td> <td>5</td> </tr> | |||
<tr align=right> <td>Phusion</td> <td>1µl</td> <td>3.5</td> <td>10</td> </tr> | |||
<tr><td></td></tr> | |||
<tr align=right> <td>template DNA</td> <td>0.1µl</td> <td>--</td> <td>--</td> </tr> | |||
</table> | |||
'''PCR program''' | |||
*30"@98C; | |||
*35x (10"@98°C; 15"@68C; 1'30"@72C); | |||
*10'@72C; | |||
*inf. 4C | |||
'''Post-Processing''' | |||
# | # add 1µl DpnI, incubate for 1h @ 37°C | ||
#* | #* mix the tube so that the enzyme contacts all surfaces | ||
# | #* longer (2h) incubation may still reduce background | ||
## | # heat-inactivate 20'@80°C | ||
## | # purify with PCR purification kit | ||
#*elute in water **not** elution buffer | |||
# dilute to 28 ng/µl (we assume a 10 % dilution by the following Phosphatase treatment) | |||
# proceed with restriction C | |||
#* add 2µl restriction mix C to each 8µl DNA | |||
#* incubate for 3h @ 37°C | |||
#* heat-inactivate 20' @ 80°C | |||
# proceed with [[Phosphatase_treatment_of_linearized_vector | phosphatase treatment]] | |||
#* add 10 x antarctic phospatase buffer to 1 x final concentration | |||
#* add 1µl [[Antarctic Phosphatase]] | |||
#* incubate 1h @ 37°C; heat-inactivate 5' @ 65°C | |||
# verify samples on 1% Agarose gel | |||
==Notes== | ==Notes== | ||
| Line 51: | Line 78: | ||
==References== | ==References== | ||
<!-- If this protocol has papers or books associated with it, list those references here. See the [[OpenWetWare:Biblio]] page for more information. --> | <!-- If this protocol has papers or books associated with it, list those references here. See the [[OpenWetWare:Biblio]] page for more information. --> | ||
<!-- | |||
'''Example reference''' | |||
<biblio> | <biblio> | ||
#Ptashne-Genetic-Switch isbn=0879697164 | #Ptashne-Genetic-Switch isbn=0879697164 | ||
</biblio> | </biblio> | ||
--> | |||
==Contact== | ==Contact== | ||
* | *[[Special:Emailuser/Raik|Raik]] | ||
or instead, [[Talk:{{PAGENAME}}|discuss this protocol]]. | or instead, [[Talk:{{PAGENAME}}|discuss this protocol]]. | ||
| Line 66: | Line 93: | ||
<!-- You can tag this protocol with various categories. See the [[Categories]] page for more information. --> | <!-- You can tag this protocol with various categories. See the [[Categories]] page for more information. --> | ||
[[Category:Protocol]] | [[Category:Protocol]] | ||
[[Category:DNA]] | [[Category:DNA]] | ||
Latest revision as of 08:19, 18 August 2010
Overview
A PCR reaction to generate linearized construction vector backbones for Fusion(Freiburg)-formatted Biobrick assemblies.
The classic assembly protocol digests the target vector (usually pSB1*) in parallel to the digestions of the two Biobrick parts. We prefer to create a stock of target backbone by PCR with a fast high-fidelity polymerase. This way, mutations in the ccdB death cassette of the target vector cannot escape selection.
Materials
- 100 ul + PCR tubes
- Phusion HotStart Polymerase 2 U/ul
- Phusion HF Buffer 5x
- dNTP mix 10mM each nucleotide
- ddH2O
- reverse prefix primer rg0301 (CRG) -- -- BBa_J18910 (RFC 25 format, ACCGGTTAATACTAGTAGCGGCC)
- reverse suffix primer rg0302 (CRG) -- BBa_J18911(RFC 25 format, GCCGGCCATCTAGAAGCG)
- vector template DNA
- DpnI restriction enzyme
- Antarctic Phosphatase and 10 x buffer
Procedure
setup PCR reaction
| µl, single reaction | 3.5xMaster | 10xMaster | |
|---|---|---|---|
| H2O | 76µl | 266 | 760 |
| 5x HF Buffer | 20µl | 70 | 200 |
| 10mM dNTP | 2µl | 7 | 20 |
| rg0301 100 µM | 0.5µl | 1.75 | 5 |
| rg0302 100 µM | 0.5µl | 1.75 | 5 |
| Phusion | 1µl | 3.5 | 10 |
| template DNA | 0.1µl | -- | -- |
PCR program
- 30"@98C;
- 35x (10"@98°C; 15"@68C; 1'30"@72C);
- 10'@72C;
- inf. 4C
Post-Processing
- add 1µl DpnI, incubate for 1h @ 37°C
- mix the tube so that the enzyme contacts all surfaces
- longer (2h) incubation may still reduce background
- heat-inactivate 20'@80°C
- purify with PCR purification kit
- elute in water **not** elution buffer
- dilute to 28 ng/µl (we assume a 10 % dilution by the following Phosphatase treatment)
- proceed with restriction C
- add 2µl restriction mix C to each 8µl DNA
- incubate for 3h @ 37°C
- heat-inactivate 20' @ 80°C
- proceed with phosphatase treatment
- add 10 x antarctic phospatase buffer to 1 x final concentration
- add 1µl Antarctic Phosphatase
- incubate 1h @ 37°C; heat-inactivate 5' @ 65°C
- verify samples on 1% Agarose gel
Notes
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
- List troubleshooting tips here.
- You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
- Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
References
Contact
or instead, discuss this protocol.