User:Benji Moncivaiz: Difference between revisions
No edit summary |
|||
| Line 59: | Line 59: | ||
2011 | 2011 | ||
===Telephone #=== | ===Telephone #=== | ||
===Email=== | ===Email=== | ||
Latest revision as of 02:26, 7 November 2010
Contact Info

- Benji Moncivaiz
- MIT
- Address 1
- Address 2
- City, State, Country etc.
- Email me through OpenWetWare
Mod2
Day1: Protein Engineering with PCR assignment
Forward primer: FLAP landing sequence 5’ CAAATAAGGGAATTTCTTGAAGAGATTGTAGATACACAA tccatggaaaagagaagatg 3’
Reverse Primer: FLAP landing sequence 5’ TGT AAT AAT ATT GGG AAT TAA GGT GCA TTT TCG TAT CCT tacgactcactatagggcga 3’
Education
- Year, PhD, Institute
- Year, MS, Institute
- Year, BS, Institute
Research interests
- Interest 1
- Interest 2
- Interest 3
Publications
- Goldbeter A and Koshland DE Jr. An amplified sensitivity arising from covalent modification in biological systems. Proc Natl Acad Sci U S A. 1981 Nov;78(11):6840-4. DOI:10.1073/pnas.78.11.6840 |
- JACOB F and MONOD J. Genetic regulatory mechanisms in the synthesis of proteins. J Mol Biol. 1961 Jun;3:318-56. DOI:10.1016/s0022-2836(61)80072-7 |
leave a comment about a paper here
- ISBN:0879697164
Please copy the source code from this page to your user page, fill in the answers and print out a copy for next time.
You do not need to keep the information on your user page once you've printed it out.
Registration/Questionnaire: 20.109 Fall 2008
Last Name
Moncivaiz II
First Name
Benjamin
Preferred name
Benji
Course/Minor
2 / (20&4)
Year of Graduation
2011
Telephone #
benmonci AT mit DOT edu
Have you taken or are you taking...
7.05/5.07 (Biochemistry) Not yet.
7.06 (Cell Biology) No.
7.02 (General Biology Lab) Nope.
5.310 (General Chemistry Lab) Definitely not :)
Do you have any experience culturing cells (mammalian, yeast or microbial)?
No
Do you have any experience in molecular biology (electrophoresis, PCR, etc)?
No
Please briefly describe any previous laboratory experience
I worked in a lab with HST. I was fabricating microwells made of polyethylene glycol (PEG) with "stamps" made from DMSO. I was also printing A6 polymer into these microwells, hoping later to find any effects A6 had on the cells our collaborators cultured in them. I did not get to work with any of the cells (staining, passaging) or do any work under the hood, but I got to do a lot of work leading up to that and making it possible!
Anything else you would like us to know?
I am basically a clean slate, as you can tell, and I am excited to get my hands on some good biology!