Biomod/2011/Caltech/DeoxyriboNucleicAwesome/Sequence Design: Difference between revisions
YAE LIM Lee (talk | contribs) No edit summary |
|||
| (3 intermediate revisions by the same user not shown) | |||
| Line 5: | Line 5: | ||
After having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced. | After having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced. | ||
After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences. | After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences. | ||
Detachers were strands that were meant to detach the corresponding strand from the origami, so we could test our results on origami using gel electrophoresis, but we decided to not run such experiments due to the potential difficulty of seeing bands corresponding to small strands of DNA when running origami in a gel. Additionally, we felt our other methods (fluorescence spectroscopy and atomic force microscopy) were sufficient for showing our mechanisms work on origami. Therefore, we have never used the detacher strands. | |||
==List of Domains== | ==List of Domains== | ||
| Line 86: | Line 88: | ||
|- | |- | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u<sub>1</sub> | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| <code> | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| <code>GACTCT</code> | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code> | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>AGAGTC</code> | ||
|- | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u<sub>2</sub> | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| <code>CCTTTC</code> | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>GAAAGG</code> | |||
|- | |- | ||
| Line 173: | Line 180: | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| lp* up<sub>cg</sub>* cgd* | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| lp* up<sub>cg</sub>* cgd* | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 87 | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 87 | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>Staple - | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>Staple - TTAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGTGTGGGTAGGAGTTAGT</code> | ||
|- | |- | ||
| Line 264: | Line 271: | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u<sub>1</sub>* x* l* | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u<sub>1</sub>* x* l* | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 27 | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 27 | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code> | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>AGAGTCAATAGAAAGGAGATAGAATGG</code> | ||
|- | |- | ||
| Line 271: | Line 278: | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| l x u<sub>1</sub> up<sub>cg</sub> | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| l x u<sub>1</sub> up<sub>cg</sub> | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 47 | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 47 | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code> | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>CCATTCTATCTCCTTTCTATTGACTCTACTAACTCCTACCCACACCT</code> | ||
|- | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo 2 | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| C<sub>1</sub> | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| u<sub>1</sub>* x* l* | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 27 | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>GAAAGGAATAGAAAGGAGATAGAATGG</code> | |||
|- | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Cargo Goal 2 | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| CG<sub>1</sub> | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| l x u<sub>1</sub> up<sub>cg</sub> | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px"| 47 | |||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 0 1px 1px"| <code>CCATTCTATCTCCTTTCTATTCCTTTCCAACTCTCCACTCCAATCAA</code> | |||
|- | |- | ||
|style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Sub Cargo Goal | |style="border-style: solid; background-color:#f9f9f9; border-color: #aaaaaa; border-width: 0 1px 1px 0"| Sub Cargo Goal | ||
Latest revision as of 17:53, 3 November 2011
|
Friday, February 27, 2026
|
Sequence DesignDesign ProcessAfter having designed our mechanism at the domain level, we needed to fill in our domains with actual sequences. To start, we picked specific lengths for each of our domains. We decided to stick with the general precedent that toeholds be 6 nucleotides in length, then decided that any domain that was part of a probe be 20 nucleotides in length, as this length is both not wastefully long and long enough to ensure that no spontaneous dissociation would occur. We then decided that any domain longer than a toehold, but not part of the probe system should be 15 base pairs in length, as this would not spontaneously dissociate, but could be easily strand displaced. After these numbers were decided, we consulted a list of 20 nucleotide sequences that are known to be relatively inert and chose sequences from this list to fill in our 20 and 15 nucleotide domains. We used NUPACK and a little trial and error to find our 7 necessary relatively inert toeholds. We then ran a number of simulations in NUPACK to check for unwanted secondary structures and interactions in our designed sequences. Detachers were strands that were meant to detach the corresponding strand from the origami, so we could test our results on origami using gel electrophoresis, but we decided to not run such experiments due to the potential difficulty of seeing bands corresponding to small strands of DNA when running origami in a gel. Additionally, we felt our other methods (fluorescence spectroscopy and atomic force microscopy) were sufficient for showing our mechanisms work on origami. Therefore, we have never used the detacher strands. List of DomainsProbe DomainsThe length of these sequences is 20 nucleotides.
† The lp domain is 27 nucleotides long. Toehold DomainsThe length of these sequences is 7 nucleotides.
† The a2' domain is a subset of the a2 domain and is 4 nucleotides long. Other DomainsThe length of these sequences is 15 nucleotides.
List of Strands
A star(*) denotes the complement of a domain.
Staple sequences for the rectangular origami were from Rothemund, P. W. K. (2006).
|
