IGEM:MIT/2006/Notebook/2006-8-3: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
| (17 intermediate revisions by 3 users not shown) | |||
| Line 1: | Line 1: | ||
==Today's big plan== | |||
#design pchBA primers '''-done''' | |||
#*pchB forward | |||
#*pchA reverse | |||
#*2 pchA mutagenesis | |||
#PCR cleanup BAT2 and THI3 [nanodrop] '''-done''' | |||
#miniprep overnight LCs [nanodrop] '''-done''' | |||
#LC R0040-E0840 '''-done''' | |||
#start digests -'''done: 11:30''' | |||
#sequence correct (3) ATF1mut-Term assemblies '''-done''' | |||
#*discard all ATF1mut-Term plates b/c we have an index plate '''-done''' | |||
#autoclave waste '''-done''' | |||
#pour plates (A/T, A) '''-done''' | |||
#design gels (small wells for 3-part assemblies versus big wells for gel extracts) '''-done''' | |||
#digest gel expectations????? '''-done''' | |||
#heat shock digests '''-done''' | |||
#load 3 digest product gels (and run THI3 again to get more DNA) '''-done''' | |||
#PCR clean-ups on necessary digests [nanodrop] '''-done''' | |||
#read digest gels and design ligations based on results '''-done''' | |||
#gel extraction '''-done''' | |||
#ligate (15 mins) '''-done''' | |||
#design TH13 mutagenesis primers '''-done''' | |||
#check all primers and email order to Heather '''-done''' | |||
#transform '''-done''' | |||
#label plates '''-done''' | |||
#set a team meeting time '''-done''' | |||
==Template Idea== | ==Template Idea== | ||
[[../../Template]] | [[../../Template]] | ||
| Line 6: | Line 33: | ||
==Miniprep/Digest To Do== | ==Miniprep/Digest To Do== | ||
#Miniprep BSMT.B0015 LC | #Miniprep BSMT.B0015 LC | ||
#Cut BSMT.B0015 with XP | #Cut BSMT.B0015 with XP | ||
| Line 39: | Line 65: | ||
#BAT2 with EP, ligate with A/C and A/T<sub>EP</sub> | #BAT2 with EP, ligate with A/C and A/T<sub>EP</sub> | ||
#THI3 with SX | #THI3 with SX | ||
# | #pSB1AK3 with SX | ||
==IAA Ligations== | ==IAA Ligations== | ||
#BAT2<sub>EP</sub> w/ A/C & A/T BKB | #BAT2<sub>EP</sub> w/ A/C & A/T BKB | ||
#THI3<sub>SX</sub> w/ psBIAK3<sub>SX</sub>->A/K plate | #THI3<sub>SX</sub> w/ psBIAK3<sub>SX</sub>->A/K plate | ||
==new pchBA primers== | |||
*pchA reverse new: G TTT CTT TAC TAG TAT TAT Tag gcg acg ccg cgc tg [melt temp = 65.6, no hairpin] | |||
*pchB forward new: GTT TCT ACG AAT TCG CGG CCG CTT CTA Gat gaa aac tcc cga aga ctg cac | |||
*pchA mut forward new: gat cga ccc att gga ccc gct '''a'''ca ggt att cgg tgc | |||
*pchA mut reverse new: gca ccg aat acc tg'''t''' agc ggg tcc aat ggg tcg atc | |||
*THI3 mut: possible problem...5 base pairs match up to create hairpin.... | |||
Primer pair 1 | |||
* | |||
Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3' | |||
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3' | |||
* | |||
GC content: 45.16% Location: 40-70 | |||
Melting temp: 75.2°C Mismatched bases: 1 | |||
Length: 31 bp Mutation: Substitution | |||
5' flanking region: 15 bp Forward primer MW: 9439.27 Da | |||
3' flanking region: 15 bp Reverse primer MW: 9590.34 Da | |||
Primer pair 2 | |||
* | |||
Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3' | |||
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3' | |||
* | |||
GC content: 46.88% Location: 39-70 | |||
Melting temp: 76.7°C Mismatched bases: 1 | |||
Length: 32 bp Mutation: Substitution | |||
5' flanking region: 16 bp Forward primer MW: 9768.48 Da | |||
3' flanking region: 15 bp Reverse primer MW: 9879.53 Da | |||
==Notes== | |||
Poor Nanodrop turnouts => don't use PSB1AK3 and B0032 | |||
Latest revision as of 01:32, 4 August 2006
Today's big plan
- design pchBA primers -done
- pchB forward
- pchA reverse
- 2 pchA mutagenesis
- PCR cleanup BAT2 and THI3 [nanodrop] -done
- miniprep overnight LCs [nanodrop] -done
- LC R0040-E0840 -done
- start digests -done: 11:30
- sequence correct (3) ATF1mut-Term assemblies -done
- discard all ATF1mut-Term plates b/c we have an index plate -done
- autoclave waste -done
- pour plates (A/T, A) -done
- design gels (small wells for 3-part assemblies versus big wells for gel extracts) -done
- digest gel expectations????? -done
- heat shock digests -done
- load 3 digest product gels (and run THI3 again to get more DNA) -done
- PCR clean-ups on necessary digests [nanodrop] -done
- read digest gels and design ligations based on results -done
- gel extraction -done
- ligate (15 mins) -done
- design TH13 mutagenesis primers -done
- check all primers and email order to Heather -done
- transform -done
- label plates -done
- set a team meeting time -done
Template Idea
[[../../Template]]
Primer To Do
- Order new pchBA primers
Miniprep/Digest To Do
- Miniprep BSMT.B0015 LC
- Cut BSMT.B0015 with XP
- Miniprep B0030
- Cut B0030 with ES and SP(bkb)
- Miniprep R0040
- Cut R0040 with ES and SP(bkb)
WG Ligations/Transformations To Do
- Gel extract BSMT.B0015XP
- PCR Cleanup B0030SP backbone
- Ligate BSMT.B0015XP and B0030SP backbone-> transform
- Ligate B0030ES with BSMT.B0015XP in A/CEP
- Ligate B0030ES with BSMT.B0015XP in A/TEP
osmY & E0840 Ligations/Transformations To Do
- osmY and A/CEP and A/TEP
- osmY cut with SpeI
- E0840 cut with XP
- Ligation of osmY cut with S and E0840 cut with XP and pSB1AK3 cut with EP
ATF1 Miniprep/Digest To Do
- Miniprep ATF1.B0015 LC
- Cut ATF1.B0015 with XP
- Gel extract some of ATF1.B0015XP
ATF1 Ligation/Transformation To Do
- Ligate ATF1.B0015XP with B0030ES in A/CEP and A/TESP
IAA Digest
- BAT2 with EP, ligate with A/C and A/TEP
- THI3 with SX
- pSB1AK3 with SX
IAA Ligations
- BAT2EP w/ A/C & A/T BKB
- THI3SX w/ psBIAK3SX->A/K plate
new pchBA primers
- pchA reverse new: G TTT CTT TAC TAG TAT TAT Tag gcg acg ccg cgc tg [melt temp = 65.6, no hairpin]
- pchB forward new: GTT TCT ACG AAT TCG CGG CCG CTT CTA Gat gaa aac tcc cga aga ctg cac
- pchA mut forward new: gat cga ccc att gga ccc gct aca ggt att cgg tgc
- pchA mut reverse new: gca ccg aat acc tgt agc ggg tcc aat ggg tcg atc
- THI3 mut: possible problem...5 base pairs match up to create hairpin....
Primer pair 1
*
Forward: 5' CCGCTTCTAGATGAACTCTAGCTATACACAG 3'
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGG 3'
*
GC content: 45.16% Location: 40-70
Melting temp: 75.2°C Mismatched bases: 1
Length: 31 bp Mutation: Substitution
5' flanking region: 15 bp Forward primer MW: 9439.27 Da
3' flanking region: 15 bp Reverse primer MW: 9590.34 Da
Primer pair 2
*
Forward: 5' GCCGCTTCTAGATGAACTCTAGCTATACACAG 3'
Reverse: 5' CTGTGTATAGCTAGAGTTCATCTAGAAGCGGC 3'
*
GC content: 46.88% Location: 39-70
Melting temp: 76.7°C Mismatched bases: 1
Length: 32 bp Mutation: Substitution
5' flanking region: 16 bp Forward primer MW: 9768.48 Da
3' flanking region: 15 bp Reverse primer MW: 9879.53 Da
Notes
Poor Nanodrop turnouts => don't use PSB1AK3 and B0032