BME494 Project Group6: Difference between revisions
| (9 intermediate revisions by the same user not shown) | |||
| Line 48: | Line 48: | ||
<!--Delete the line items that do not apply to your project --> | <!--Delete the line items that do not apply to your project --> | ||
We picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[http://www.ncbi.nlm.nih.gov/gene/4036909]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: | |||
Forward primer: '''gaattcgcggccgcttctag'''atggccgttcgtctgcccgt | |||
Reverse primer: tactagtagcggccgctgcag'''tcagtgtgcatgtccgcaat''' | |||
Note: The bold sections of the primers are the standard BioBrick primers, while the other sections are specific to our natural part. | |||
<br> | <br> | ||
| Line 57: | Line 62: | ||
<!--Draw out plasmids, restriction digests, antibiotics used, etc. --> | <!--Draw out plasmids, restriction digests, antibiotics used, etc. --> | ||
[[Image: | [[Image:Group6_plasmidassembly.jpg|right|400px]] | ||
Because our plasmid has ampicillin resistance and standard BioBrick restriction sites, it is fairly easy to construct our genes in the way we specify in the schematic to the right. The addition of each consecutive gene is rather formulaic. Say, for example, that we have a kanamycin resistant plasmid with a BioBricked form of RFP. Because this part is already a biobrick, it will have the E, X, S, and P restriction sites present in the nucleotide sequence. We can cut the DNA at the X and P sites to prepare the gene to be added to a new plasmid. In our specific case, our next gene is a ribosome binding site. We can prepare the plasmid containing the RBS by cutting at the E and S sites, which will then allow it to receive the RFP. Then, the environment can be treated with ampicillin, which will remove all of the plasmids from which the RFP was taken, preserving the new plasmids which have ampicillin resistance. We can repeat this same process for the addition of each gene. | |||
<br><br><br><br><br> | <br><br><br><br><br> | ||
| Line 99: | Line 104: | ||
<div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px"> | <div style="color: #808080; background-color: #ffffff; width: 600px; padding: 5px"> | ||
[[Image:BME494_profile.jpg|thumb|noframe|150px|left|''' | [[Image:BME494_profile.jpg|thumb|noframe|150px|left|'''Jeremy Blazer''']]Sophomore in Biomedical Engineering. Taking BME 494 so that he can learn how to engineer E. Coli to do his bidding. Something interesting about him is that he has a twin sister who also goes to ASU! | ||
</div> | </div> | ||
<br> | <br> | ||
Latest revision as of 18:26, 15 March 2012
Home People Course Projects Course Materials Syllabus Photos Wiki Editing Help
ABSTRACT![]() Our goal was to create a strain of E. Coli which could produce vitamin B-12 (cobalamin) to help people who have vitamin B-12 deficiency. Vitamin B-12 deficiency is especially common in vegetarians and vegans, because it is found almost exclusively in meats and dairy products. In order to achieve B-12 production in E. Coli, we extracted the DNA sequence coding for the cobW gene in Cupriavidus metallidurans using PCR, and inserted the gene into an Ampicillin resistant plasmid, linking its production to GFP for proof of concept. Although humans are fairly good at removing excess vitamin B-12 due to its solubility in water, having unrestrained B-12 production in the body still is an unnecessary risk. In order to control the production of B-12, we included a protein (linked to RFP)which can degrade vitamin B-12. By choosing ribosome binding sites with varying efficiencies, we can tune the amount of B-12 producing protein and B-12 degrading protein present in the system, which will ultimately allow us to maintain a healthy level of B-12 in the patient. If successful, we will hopefully create a safe way to help those who suffer from vitamin B-12 deficiency to enjoy a better quality of life.
BACKGROUND![]() When picking an objective for our project, we aimed to produce a substance necessary to the survival of humans which the human body cannot produce independently. Vitamin B-12 in particular is not produced by the body, and many people, especially vegetarians and vegans, have low levels of B-12 due to the fact that it is found almost exclusively in meat and dairy products. Low levels of B-12 can lead to the expression of serious psychological symptoms including mania, psychosis, fatigue, memory impairment, irritability, depression, and personality changes. In most cases, the effects of vitamin B-12 deficiency on the nervous system are reversible. However, in certain studies, it has been linked to the onset of Alzheimer's disease. Because of the severity of symptoms associated with B-12 deficiency and relative simplicity of the cause, taking this project on seemed like a realistic and beneficial application of our time and resources. The novel aspect of this project comes from our natural part: the cobW gene we extracted from Cupriavidus metallidurans. Once our E. Coli is in a human, the human body will now have the capability to produce a substance which it previously was dependent upon external sources for, which is novel in itself.
PROOF OF CONCEPT DESIGNWe picked this gene for several reasons, the most important of which is the fact that it can produce vitamin B12. In addition, the gene itself has relatively few base pairs, and there was no need for site directed mutagenesis because there were no BioBrick restriction sites within the base pair sequence. We found the cobW gene ([[1]]) via the NCBI database when searching for vitamin B12 synthesis. Our primers are as follows: Forward primer: gaattcgcggccgcttctagatggccgttcgtctgcccgt Reverse primer: tactagtagcggccgctgcagtcagtgtgcatgtccgcaat Note: The bold sections of the primers are the standard BioBrick primers, while the other sections are specific to our natural part.
Because our plasmid has ampicillin resistance and standard BioBrick restriction sites, it is fairly easy to construct our genes in the way we specify in the schematic to the right. The addition of each consecutive gene is rather formulaic. Say, for example, that we have a kanamycin resistant plasmid with a BioBricked form of RFP. Because this part is already a biobrick, it will have the E, X, S, and P restriction sites present in the nucleotide sequence. We can cut the DNA at the X and P sites to prepare the gene to be added to a new plasmid. In our specific case, our next gene is a ribosome binding site. We can prepare the plasmid containing the RBS by cutting at the E and S sites, which will then allow it to receive the RFP. Then, the environment can be treated with ampicillin, which will remove all of the plasmids from which the RFP was taken, preserving the new plasmids which have ampicillin resistance. We can repeat this same process for the addition of each gene.
TESTING
HUMAN PRACTICESOUR TEAM
|







