Sacks:RAD-seq: Difference between revisions
setup |
|||
| Line 1: | Line 1: | ||
==Overview== | ==Overview== | ||
This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to ''Pst''I sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall. | This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to ''Pst''I sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks' lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall. | ||
==Materials== | ==Materials== | ||
Revision as of 22:26, 21 September 2012
Overview
This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to PstI sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks' lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall.
Materials
Reagents
- Quant-iT Picogreen kit (Invitrogen)
- Qiagen gel purification kit
- Qiagen PCR cleanup kit
- From New England Biolabs:
- PstI-HF, 20,000 U/mL
- MspI, 20,000 U/mL
- T4 DNA ligase, 2,000,000 U/mL
- ATP
- Phusion High Fidelity PCR master mix
Oligonucleotides
PstI adapters
This is the most expensive part of the protocol other than the sequencing itself, since 192 oligonucleotides must be ordered.
Adapter 1 top: 5'GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA3'
Adapter 1 bottom: 5'yyyyAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATC3'
Where xxxx and yyyy are the barcode and its reverse complement, respectively.
Barcodes are from Elshire et al. (2011).
Other oligos
Equipment
- Nanodrop spectrophotometer
- BioTek Synergy plate reader (for reading fluorescence)
- Ordinary PCR machine
- Agarose gel rig
- Bioanalyzer
- real-time PCR machine (we just pay the core facility to do that part)
Procedure
Adapter prep
DNA quantification and dilution
Restriction digestion and ligation
Cleanup and amplification
Quality control
Bioinformatics
Notes
Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!
- List troubleshooting tips here.
- You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
- Anecdotal observations that might be of use to others can also be posted here.
Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.
References
- Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, and Mitchell SE (2011) "A robust, simple Genotyping-by-Sequencing (GBS) approach for high diversity species." PLoS One 6(5): e19379. doi:10.1371/journal.pone.0019379
Contact
- Who has experience with this protocol?
or instead, discuss this protocol.