Sacks:RAD-seq: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Adapter prep: filling in content
Line 53: Line 53:


===Adapter prep===
===Adapter prep===
Top and bottom strands of adapters need to be annealed 1X Annealing Buffer, which is 10 mM Tris, 50 mM NaCl.
The annealing program is:
* 95°C 5 minutes
* Ramp down -0.1°C every 2 seconds (or -1°C every 20 seconds) to 25°C.
My protocol:
* Pat Brown provided us with a plate of ''Pst''I adapters that are at 1 μM.  I took a bottle of autoclaved 1X Annealing Buffer, added 45 μl to each well of a 96-well plate, then transferred 5 μl from the 1 μM plate to make a 0.1 μM working stock.
* ''Msp''I adapters are ordered like normal oligos, and I have 100 μM concentrated stocks in TE.  To make a 10 μM stock:
** 20 μl A2top, 100 μM
** 20 μl A2bot, 100 μM
** 20 μl 500 mM NaCl
** 2 μl 1M Tris
** 138 μl nuclease-free water
** Mix well, add 100 μl to each of two PCR tubes, and run them on the annealing program ("Adapt" on the PCR machine).


===DNA quantification and dilution===
===DNA quantification and dilution===

Revision as of 15:36, 24 September 2012

Overview

This is a protocol for generating RAD libraries for Illumina sequencing. With this technique, 96 samples can be multiplexed into one sequencing library, and only tags adjacent to PstI sites are sequenced. This is a cheap way to both mine and genotype large numbers of SNPs. This is the protocol developed in Erik Sacks' lab at UIUC by Lindsay Clark, based on protocols from Pat Brown and Megan Hall.

Materials

Reagents

  • Quant-iT Picogreen kit (Invitrogen)
  • Qiagen gel purification kit
  • Qiagen PCR cleanup kit
  • From New England Biolabs:
    • PstI-HF, 20,000 U/mL
    • MspI, 20,000 U/mL
    • T4 DNA ligase, 2,000,000 U/mL
    • ATP
    • Phusion High Fidelity PCR master mix

Note: MspI is not a heat-inactivated enzyme, but I have found that the protocol works anyway. Between the ligation and gel extraction steps, I keep the sample on ice to prevent any residual digestion activity.

  • You will also need a black microtiter plate for the Picogreen assay.

Oligonucleotides

PstI adapters

This is the most expensive part of the protocol other than the sequencing itself, since 192 oligonucleotides must be ordered.

Adapter 1 top: 5'GATCTACACTCTTTCCCTACACGACGCTCTTCCGATCTxxxxTGCA3'

Adapter 1 bottom: 5'yyyyAGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATC3'

Where xxxx and yyyy are the barcode and its reverse complement, respectively.

Barcodes and oligo sequences are from Pat Brown's lab.

Media:PstI-barcodes.txt

Other oligos

MspI adapters:

  • A2top: 5'CGCTCAGGCATCACTCGATTCCTCCGAGAACAA3'
  • A2bot: 5'CAAGCAGAAGACGGCATACGACGGAGGAATCGAGTGATGCCTGAG3'

Illumina PCR primers:

  • PCR1: 5'AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3'
  • PCR2: 5'CAAGCAGAAGACGGCATACGA3'

Equipment

  • Nanodrop spectrophotometer
  • BioTek Synergy plate reader (for reading fluorescence)
  • Ordinary PCR machine
  • Agarose gel rig
  • Bioanalyzer
  • real-time PCR machine (we just pay the core facility to do that part)

Procedure

Adapter prep

Top and bottom strands of adapters need to be annealed 1X Annealing Buffer, which is 10 mM Tris, 50 mM NaCl.

The annealing program is:

  • 95°C 5 minutes
  • Ramp down -0.1°C every 2 seconds (or -1°C every 20 seconds) to 25°C.

My protocol:

  • Pat Brown provided us with a plate of PstI adapters that are at 1 μM. I took a bottle of autoclaved 1X Annealing Buffer, added 45 μl to each well of a 96-well plate, then transferred 5 μl from the 1 μM plate to make a 0.1 μM working stock.
  • MspI adapters are ordered like normal oligos, and I have 100 μM concentrated stocks in TE. To make a 10 μM stock:
    • 20 μl A2top, 100 μM
    • 20 μl A2bot, 100 μM
    • 20 μl 500 mM NaCl
    • 2 μl 1M Tris
    • 138 μl nuclease-free water
    • Mix well, add 100 μl to each of two PCR tubes, and run them on the annealing program ("Adapt" on the PCR machine).

DNA quantification and dilution

Restriction digestion and ligation

Cleanup and amplification

Quality control

Bioinformatics

Notes

Please feel free to post comments, questions, or improvements to this protocol. Happy to have your input!

  1. List troubleshooting tips here.
  2. You can also link to FAQs/tips provided by other sources such as the manufacturer or other websites.
  3. Anecdotal observations that might be of use to others can also be posted here.

Please sign your name to your note by adding '''*~~~~''': to the beginning of your tip.

References

  • Elshire RJ, Glaubitz JC, Sun Q, Poland JA, Kawamoto K, Buckler ES, and Mitchell SE (2011) "A robust, simple Genotyping-by-Sequencing (GBS) approach for high diversity species." PLoS One 6(5): e19379. doi:10.1371/journal.pone.0019379

Contact

  • Who has experience with this protocol?

or instead, discuss this protocol.