Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
Line 38: Line 38:


===October 5th===
===October 5th===
[[Image:Biomod-2012-UTkyo-UTKomaba-AFM-mod_origami.png|center|Modified Origami]]


We made modified origami in September 3rd and keep them at the laboratory room temperture.
We made modified origami in September 3rd and keep them at the laboratory room temperture.
Line 43: Line 46:
The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done.
The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done.
Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface.
Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface.
[[Image:Biomod-2012-UTkyo-UTKomaba-AFM-mod_origami.png]]

Revision as of 16:49, 23 October 2012

<html>

<style type="text/css"> </style>

</html>

Concept

Modified Origami Concept
Modified Origami Concept

We combine DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerhead forms and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strand necessary for the hammerhead structure DNAs do not disturb during annealing in PCR. We observe the modified DNA origami with cover DNA by AFM.

Method

pseudo-hammerhead structure

To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

Hammerhead structure
GGAACCTCAGCCCAACTAACAT

This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.

(5' -> 3' direction)

addition to staple cover
1 CTCCAAGGTTT - TTTAGCCCAAC GAGGTTCCTCGGGTTG
2 CGACTCCATTT - TTTCCAACTAA TGGGCTGATGATTGTA
3 ACCCGACTTTT - TTTACTAACAT GCTGAGGTGGTTGATT

Experiment

October 5th

Modified Origami
Modified Origami


We made modified origami in September 3rd and keep them at the laboratory room temperture. We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami. The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done. Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface.