Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami: Difference between revisions
No edit summary |
No edit summary |
||
| Line 39: | Line 39: | ||
==Experiment== | ==Experiment== | ||
===October 3rd=== | |||
We design modified origami and annealed them for about an hour in PCR. | |||
On the surface of one origami, there are 15 hummer head structure and 1 hairpin structure. | |||
Therefore, we order DNA which composes the structures and replace staple strands of normal origami with them. | |||
We drew three lines on the surface by the hummer head structures, and one line consisted of 5 structures which have the same number of bases. | |||
The numbers of bases of the structures are 16, 18 and 20. | |||
(µL) | |||
{| | |||
! | |||
! Modified Staple Mix | |||
! M13 | |||
! TAE 10x | |||
! Mg2+ | |||
! mQ | |||
! Total Amount | |||
|- | |||
| 10x | |||
|8.00 | |||
|3.33 | |||
|2.00 | |||
|0.25 | |||
|6.42 | |||
|20.00 | |||
|} | |||
===October 5th=== | ===October 5th=== | ||
| Line 45: | Line 72: | ||
We made modified origami in | We made modified origami in October 3rd and keep them at the laboratory room temperture. | ||
We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami. | We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami. | ||
The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done. | The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done. | ||
Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface. | Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface. | ||
Revision as of 17:29, 23 October 2012
<html>
<style type="text/css"> </style>
</html>
Concept

We combine DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerhead forms and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strand necessary for the hammerhead structure DNAs do not disturb during annealing in PCR. We observe the modified DNA origami with cover DNA by AFM.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

| GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this.
(5' -> 3' direction)
| addition to staple | cover | |
|---|---|---|
| 1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
| 2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
| 3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
Experiment
October 3rd
We design modified origami and annealed them for about an hour in PCR. On the surface of one origami, there are 15 hummer head structure and 1 hairpin structure. Therefore, we order DNA which composes the structures and replace staple strands of normal origami with them. We drew three lines on the surface by the hummer head structures, and one line consisted of 5 structures which have the same number of bases. The numbers of bases of the structures are 16, 18 and 20.
(µL)
| Modified Staple Mix | M13 | TAE 10x | Mg2+ | mQ | Total Amount | |
|---|---|---|---|---|---|---|
| 10x | 8.00 | 3.33 | 2.00 | 0.25 | 6.42 | 20.00 |
October 5th
We made modified origami in October 3rd and keep them at the laboratory room temperture.
We observed the modified origami by AFM and we get the clear picture of lines on the surface of the origami.
The three lines on the surface shows the fact that the modified origami which have hummer head structures was well-done.
Also, the picture below proved that we can observe a hummer head structure as a dot so that we can draw a picture on the origami surface.
