Biomod/2012/TU Dresden/Nanosaurs/Project/Aptamer lock: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 2: Line 2:
<html>
<html>
<body>
<body>
<style>
body{
width:960px;
margin:auto;
}
</style>
    <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" />
<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" />
<script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script>
<script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script>
<script>
$(function() {
$( "#tabs" ).tabs();
});
</script>


<div id="main_saurs">
<div id="main_saurs">

Revision as of 02:31, 28 October 2012

<html> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.smooth-scroll.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/lightbox.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.queryloader2.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/superfish.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.hoverIntent.minified.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.scrollTo-1.4.3.1-min.js"></script> <script type="text/javascript" src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery.localscroll-1.2.7-min.js"></script> <link href='http://fonts.googleapis.com/css?family=Merriweather:400,700' rel='stylesheet' type='text/css'> <link href='http://biomod-dresden-2012.googlecode.com/svn/trunk/css/superfish.css' rel='stylesheet' type='text/css'> <link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/css/lightbox.css" type="text/css" media="screen" /> <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" /> <script type"text/javascript"> // Main function that waits for the browser to be ready $(document).ready(function(){ //make css accesible, please change the alter_css to chnage the style var alter_css = $("#alter_css").html(); $("style").remove(); $('head').append('<link rel="stylesheet" href="/skins/monobook/shared.css?164" type="text/css" />'); $('head').append('<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" type="text/css" />'); //additional divs

$(".firstHeading").wrap('

'); $(".firstHeading").wrap('

'); $(".firstHeading").wrap('

');

var nav = $("#nav").html(); $('#inner_header').append(nav);

$('#inner_header').append('

');

//clean up wiki framework $("#sidebar-main").remove(); $(".portlet").remove(); //fix breadcrumbs $('#contentSub').remove(); //fix heading var h1 = $(".firstHeading").text().split("/"); $(".firstHeading").text(h1[h1.length-1]); //start plugins for navigation $("ul.sf-menu").superfish({ delay: 800, // one second delay on mouseout animation: {opacity:'show',height:'show'}, // fade-in and slide-down animation speed: 'normal', // faster animation speed }); $('#main_saurs').localScroll(); $("tr:odd").addClass("odd");

}); </script>

<script type="text/javascript"> var _gaq = _gaq || []; _gaq.push(['_setAccount', 'UA-35720700-1']); _gaq.push(['_trackPageview']);

(function() { var ga = document.createElement('script'); ga.type = 'text/javascript'; ga.async = true; ga.src = ('https:' == document.location.protocol ? 'https://ssl' : 'http://www') + '.google-analytics.com/ga.js'; var s = document.getElementsByTagName('script')[0]; s.parentNode.insertBefore(ga, s); })(); </script> <script type="text/javascript">var addthis_config = {"data_track_addressbar":false};</script> <script type="text/javascript" src="http://s7.addthis.com/js/300/addthis_widget.js#pubid=ra-508414b242f27ceb"></script> <script id="nav">

</script>

</html> <html> <body>

<style> body{ width:960px; margin:auto; } </style>

   <link rel="stylesheet" href="http://code.jquery.com/ui/1.9.0/themes/base/jquery-ui.css" />

<link rel="stylesheet" href="http://biomod-dresden-2012.googlecode.com/svn/trunk/nanos.css" />

<script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-1.8.2.min.js"></script> <script src="http://biomod-dresden-2012.googlecode.com/svn/trunk/js/jquery-ui-1.9.1.custom.min.js"></script> <script> $(function() { $( "#tabs" ).tabs(); }); </script>


Aptamer Locks

The Search For Locks and Keys

After designing our DNA Origami Box, we started looking for a suitable "lock and key" system. With a suitable lock and key, we would be able to open a closed origami box, as shown in Fig.1.

<a rel="lightbox[aptamer]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a>

Fig. 1(a) Front view of a closed origami box
<a rel="lightbox[aptamer]" title="Top view of an open origami box" href="http://openwetware.org/images/b/b5/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_800.jpg"><img style="height:130px" src="http://openwetware.org/images/8/86/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_250.jpg"></a>
Fig. 1(b) Box opens when the key binds to the lock. Top view of an open origami box


For our purposes, we adapted the lock and key system based on the specific binding of PDGF (Platelet Derived Growth Factor) to an aptamer strand. Such a system has been successfully used for a similar application[1]. Aptamers are artificial specific oligonucleotides, DNA or RNA, with the ability to bind to non-nucleic acid target molecules, such as peptides, proteins, drugs, organic and inorganic molecules or even whole cells, with high affinity and specificity[2]. PDGF is one of the numerous proteins regulating cell growth and division. It is considered a potent activator for the cell types essential for tissue repair and wound healing3. In our system, we used a PDGF-specific aptamer based locking system, as described in [1]. Each lock is essentially composed of two complementary oligonuleotidic strands - an aptamer strand specific to PDGF and a strand complementary to it.

Aptamer strand: 5'TACTCAGGGCACTGCAAGCAATTGTGGTCCCAATGGGCTGAGTA3'

Aptamer locking strand: 3'ATGAGTCCCGACACGTTCGTTAACACCAGGGTTACCCGACTCAT5'

When Human PDGF-BB interacts with such a hybrid, it interacts with the Aptamer strand and the two strands of the lock dissociate. In other words the complementary strand is displaced by PDGF because it has a higher affinity to the aptamer (K = 0.129±0.011 nM)[4]. To enhance the efficiency of the system, the aptamer-locking strand is designed to be partially complementary to the aptamer strand. Such a design with shorter complementary sequences (24 bp) combined with a stretch of 16 mismatches between the two strands, increases the rate of interaction between the aptamer and PDGF. However, the lock is still stable enough when the Origami box is closed[1]. The locks were hence designed as described in Fig. 2a. The two strands of the lock are attached to the the origami box by means of Origami Attachment Sequences, complementary to the origami scaffold. In order to see how efficiently the lock and key system works we had to come up with an assay to characterize its functioning. To actualize this, BHQ labeled aptamer strands and Cy3 labeled aptamer locking strands were used to form the lock. In principle, when the DNA origami box is closed, the flouorescence of the Cy3 fluorophore is quenched due to its proximity to the BHQ (Fig. 2a). In the presence of PDGF, When the box is open, the distance between the quencher and the fluorophore (Cy3) is large enough to observe a strong Cy3 fluorescence (Fig. 2b). Consequently, opening kinetics of the structure can be detected by an increase in the Cy3 fluorescence signal.

<a rel="lightbox[aptamer]" title="Front view of a closed origami box" href="http://openwetware.org/images/2/27/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_800.jpg"><img src="http://openwetware.org/images/1/17/BM12_Nanosaurs_DNA_Origami_Closed_Aptamer_250.jpg"></a>

Fig. 1a Front view of a closed origami box
<a rel="lightbox[aptamer]" title="Top view of an open origami box" href="http://openwetware.org/images/b/b5/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_800.jpg"><img style="height:130px" src="http://openwetware.org/images/8/86/BM12_Nanosaurs_DNA_Origami_Open_Aptamer_250.jpg"></a>
Fig. 1b Top view of an open origami box

Spectrophotometric Measurements

To begin with, the experiments for characterization of the lock were performed independent of the origami. In all such experiments, the lock was a hybrid of the complete aptamer sequence and the complete aptamer locking sequence, as described in Fig. 2a. These strands will heneceforth be refered to as the aptamer strand and the aptamer locking strand respectively. Unless otherwise specified, the mention of a "lock" refers to a hydrid of the complete aptamer and aptamer locking strands, labeled with BHQ and cY3 respectively. All the samples were prepared as described under protocols. We performed experiments to obtain an optimal fluorophore (Cy3) labeled lock concentration with an optimal signal-to-noise ratio. In all such measurements, samples containing the fluorophore were excited at 510 nm and emission was recorded at 564 nm, using a spectrophotometer. Fluorescence was measured for 1 nM, 10 nM and 100 nM Cy3 labeled lock concentrations. For all these optimization measurements, only the aptamer locking strand was labeled with Cy3. The aptamer strand was not labeled with BHQ. It was observed that the intensity of fluorescence increased linearly with the concentration (Fig. 3). A 10 nM Cy3 labeled lock concentration proved optimal, based on the fluorescence spectra obtained.

Solutions with 10 nM lock concentrations were measured for fluorescence. A control experiment was also designed, in which the aptamer strand of the lock hybrid was unlabeled. In such a control, since the Cy3 fluorescence from the fluorophore on the aptamer locking strand, does not get quenched, a high fluorescence was obtained. In comparison, the lock hybrid with both labels, showed a considerably lower fluorescence signal (Fig. 5a). Hence, it was clear that the closed state of the lock is clearly discernible.

We now had the lock and had to work on opening it with its key. Samples of the lock were incubated with PDGF for 24 Hrs

[1].

PDGF was always used in a 10 times excess concentration than that of the lock. Control experiments were also designed. The negative control, consisted of the lock. Hence, very minimal signal would be expected with such a control. The positive control sample had the lock with only the aptamer locking strand labeled. In such a control, since the quencher is absent, a high flouorescence signal would be expected. However, even after repeated trials, no significant increase in fluorescenec intensity was observed in the presence of PDGF (Fig. 5b).

<a rel="lightbox" href="http://www.openwetware.org/images/c/c3/Picture1.jpg"> <img src="http://www.openwetware.org/images/c/c0/BM12_nanosaurs_lock_design_s.jpg" ></a>

Fig. 5a Fluorescence measurements with closed lock

<a rel="lightbox" href="http://www.openwetware.org/images/c/c3/Picture1.jpg"> <img src="http://www.openwetware.org/images/c/c0/BM12_nanosaurs_lock_design_s.jpg" ></a>

Fig. 5b Fluorescence measurements to study the opening of the lock

Since, the use of PDGF to open the lock hybrid did not seem to work, the question remained; Why did the PDGF key not open the aptamer lock? - What would you do if you cannot open a lock with your key? - You would probably try another key!

That is exactly what we did. We used two oligonucleotidic single strands, with sequences complementary to the aptamer strand and the aptamer locking strand, which we call blockers (Fig. 6). Blocker 1 and blocker 2 are complementary to the aptamer strand and the aptamer locking strand respectively. One may consider blockers as better keys because their interaction with the lock is guaranteed due to their sequence complementarity.

<a rel="lightbox" href="http://www.openwetware.org/images/c/c3/Picture1.jpg"> <img src="http://www.openwetware.org/images/c/c0/BM12_nanosaurs_lock_design_s.jpg" ></a>

Fig. 6a Use of blocker 1, complementary to the aptamer strand, opens the lock

<a rel="lightbox" href="http://www.openwetware.org/images/c/c3/Picture1.jpg"> <img src="http://www.openwetware.org/images/c/c0/BM12_nanosaurs_lock_design_s.jpg" ></a>

Fig. 6b Use of blocker 2, complementary to the aptamer locking strand, opens the lock

Experiments were hence also designed, including the blockers. The following samples were prepared, to serve as the experiments and the controls.

  1. Lock
  2. Lock - aptamer strand without BHQ, aptamer locking strand without Cy3
  3. Lock - aptamer strand without BHQ, aptamer locking strand without Cy3; with PDGF
  4. Lock; with PDGF
  5. Lock; with blocker 1
  6. Lock; with blocker 2
  7. Lock; with both blockers, blocker1:blocker2 = 10:1
  8. Lock; with both blockers, blocker2:blocker1 = 10:1
  9. Lock; with both blockers, blocker1:blocker2 = 10:1, sample annealed before incubation
  10. Lock; with both blockers, blocker2:blocker1 = 10:1, sample annealed before incubation

PDGF was always used in a 10 times excess concentration than that of the lock. All the samples were incubated at room temperature for 24 Hrs.

The results of this experiment are presented in Fig. 7 below.

From the results obtained, it was observed hat the blockers work better than PDGF at opening the lock hybrid. Blocker 1 was found to be more efficient than blocker 2 as expected, since Blocker 1 is complementary to the aptamer strand over a longer length than Blocker 2 to the aptamer locking strand.

Our lock and key system was adapted from previously published results [1], the only variable being that both the aptamer strand and the strand complementary to the aptamer were labeled. Hence, when our spectrophotometric measurements did not give us affirmative results, our first concern was whether the presence of the fluorophores was causing steric hinderences that prevented the key from binding to the lock. To clarify this concern, we ran a gel shift experiment (Fig. 8). The samples for each lane of the gel are as described below.

Lanes:

  1. Lock
  2. Lock; PDGF
  3. Aptamer strand with BHQ
  4. Aptamer strand with BHQ; with PDGF
  5. Aptamer locking strand with Cy3
  6. Ladder
  7. Lock - aptamer strand without BHQ, aptamer locking strand without Cy3
  8. Lock - aptamer strand without BHQ, aptamer locking strand without Cy3; PDGF
  9. Aptamer strand without BHQ
  10. 10. Aptamer strand without BHQ; PDGF

All the samples were prepared as described in (reference link). All samples were incubated at room temperature for 24 hours, before being run on the gel. A 20 bp DNA ladder was used. A shift was clearly observed everytime PDGF was present with the aptamer strand or the lock hybrid. More importantly, it was observed that labeling the strands did not affect the binding of PDGF to the aptamer.

As the next step, to reaffirm the specificity of PDGF to the aptamer strand, another gel experiment was run. The gel is shown in Fig. 9. The samples for each lane of the gel are as described below.

Lanes:

  1. PDGF
  2. Aptamer Locking Strand with Cy3; PDGF
  3. Aptamer Locking Strand with Cy3
  4. Aptamer Locking Strand
  5. Aptamer strand with BHQ
  6. Aptamer strand
  7. Lock
  8. Lock - aptamer strand without BHQ, aptamer locking strand with Cy3
  9. Lock - aptamer strand without BHW, aptamer locking strand with Cy3; with PDGF
  10. Aptamer strand without BHQ, incubated with PDGF. Aptamer Locking strand with Cy3 added after incubation period.
  11. Ladder
  12. Lock; PDGF
  13. Unspecific ds-DNA, one strand labeled with Cy3
  14. Unspecific short ds-DNA, one strand labeled with Cy3; PDGF
  15. Lock,aptamer strand without BHQ, aptamer locking strand with Cy3; blocker 1 and blocker 2

All the samples were prepared as described in (reference link). All samples were incubated at room temperature for 24 hours, before being run on the gel. A 20 bp DNA ladder was used. The gel was scanned in a gel scanner for the presence of bands rich in Cy3. A Cy3 band is seen in every lane that has DNA labeled with Cy3. In all the wells with PDGF – 2,9, 10,12 and 14, binding is observed, because Cy3 is observed in the wells. In well 9, no separate Cy3 band is observed except in the well. This suggests that the two strands of the lock hybrid do not separate when PDGF binds to the aptamer. In lanes 2 and10, a separate Cy3 band is observed, way below. This is easily explained for well 10, because, in this sample, the aptamer and PDGF were incubated for 24 hours and the complementary Cy3 labeled strand was added later. Ideally in lane 2, we should have seen just the Cy3 band in the gel with no Cy3 remanants in the well, since we expect PDGF to bind specifically only with the aptamer strand. This is however not the case. Similarly, in lane 14, we would expect just the Cy3 band in the gel with no Cy3 remanants in the well. However, we again notice unspecific binding here. These observations suggest that PDGF do not specifically bind only to the aptamer. However, in the last lane with the blockers, we observe to faint bands. One of these bands corresponds to the single stranded complementary strand. The other band corresponds to the complementary strand-blocker2 hybrid. This suggests that when the blockers are used, the lock does open.

References:

  1. Shawn M. Douglas, Ido Bachelet,George M. Church A Logic-Gated Nanorobot for Targeted Transport of Molecular Payloads SCIENCE VOL 335 17 FEBRUARY 2012,831-834
  2. Teresa Mairal , Veli Cengiz Özalp, Pablo Lozano Sánchez, Mònica Mir, Ioanis Katakis, Ciara K. O’Sullivan Aptamers: molecular tools for analytical applications Anal Bioanal Chem (2008) 390:989–1007
  3. Pierce GF, Mustoe TA, Altrock BW, Deuel TF, Thomason A. Role of platelet-derived growth factor in wound healing,J.Cell. Biochem 1991 Apr;45(4):319-26.
  4. Louis S. Green, Derek Jellinek, Robert Jenison, Arne O¬ stman, Carl-Henrik Heldin, and Nebojsa Janjic Inhibitory DNA Ligands to Platelet-Derived Growth Factor B-Chain Biochemistry 1996, 35, 14413-14424

</body> </html>