Biomod/2012/UTokyo/UT-Komaba/Experiment/Modified Origami: Difference between revisions
No edit summary |
Shun Otsubo (talk | contribs) No edit summary |
||
| (20 intermediate revisions by 3 users not shown) | |||
| Line 5: | Line 5: | ||
[[Image:Biomod_2012_UTokyo_UT-Komaba_Experiment_ModifiedOrigamiConcept.png|center|Modified Origami Concept]] | [[Image:Biomod_2012_UTokyo_UT-Komaba_Experiment_ModifiedOrigamiConcept.png|center|Modified Origami Concept]] | ||
We | We combined DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerheads form and the surface of the modified origami shows a picture. | ||
Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. | Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. | ||
The purpose of the experiment is to make sure that the additional single | The purpose of the experiment is to make sure that the additional single strands necessary for the hammerhead structure DNAs do not disturb it during annealing in PCR. | ||
We | We observed the modified DNA origami with cover DNAs by AFM. | ||
==Method== | ==Method== | ||
===Pseudo-hammerhead Structure=== | ===Pseudo-hammerhead Structure=== | ||
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below. | To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below. | ||
| Line 24: | Line 22: | ||
|} | |} | ||
This sequence is known not to interact with other parts of DNA origami. We made three hammerhead structures from this. | This sequence is known not to interact with other parts of DNA origami from Shelley F. J. Wickham et al[[Biomod/2012/UTokyo/UT-Komaba/Supplementary#References|[1]]]. We made three hammerhead structures from this. | ||
(5' -> 3' direction) | (5' -> 3' direction) | ||
| Line 37: | Line 35: | ||
|} | |} | ||
==Experiment== | |||
===October 3rd=== | |||
[[Image:Biomod_2012_UTokyo_UT-Komaba_Experiment_ModifiedOrigamiDesign1.png|center|The Design of the Modified Origami]] | |||
We designed the modified origami and annealed them for about an hour in PCR. | |||
On the surface of one origami, there are 15 hammerhead structure and 1 hairpin structure. | |||
Therefore, we ordered DNA which composes the structures to replace the staple strands of the normal origami. | |||
We drew three lines on the surface using the hammerhead structures, and one line consisted of 5 hammerhead structures. | |||
The abstract design of the origami is the picture above. | |||
[[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_3rd|More Information]] | |||
===October 5th=== | ===October 5th=== | ||
| Line 45: | Line 54: | ||
We made modified origami in | We made modified origami in October 3rd and keep them at the laboratory room temperture. | ||
We observed the modified origami by AFM and | We observed the modified origami by AFM and got the clear picture of lines on the surface of the origami. | ||
The three lines on the surface shows the fact that the modified origami which have | The three lines on the surface shows the fact that the modified origami which have hammerhead structures was well-done. | ||
Also, the picture below proved that we can observe a | Also, the picture below proved that we can observe a hammerhead structure as a dot so that we can draw a picture on the origami surface. However, we couldn't not observe the hairpin. After checking, we found out that there was a mistake when we ordered the sequences, so this modified staple couldn't form an hairpin. | ||
===October 25th=== | |||
The purpose of this experiment is to find out the reason why we could not observe the tablet by AFM on October 24th. | |||
To make sure whether we could not observe it because of the AFM or not, we made the modified origami which worked well on October 3rd. | |||
We made the modified origami in the same condition as that on October 3rd. | |||
[[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_25th|More Information]] | |||
__NOEDITSECTION__ | |||
Latest revision as of 09:22, 28 October 2012
<html>
<style type="text/css"> </style>
</html>
Concept

We combined DNA origami and pseudo-hammerhead structure so that, when cover DNAs hybridize to the structure, the hammerheads form and the surface of the modified origami shows a picture. Therefore, if we can set up the bistable system so that it produces the cover DNAs for different images, we can realize the DNA tablet. The purpose of the experiment is to make sure that the additional single strands necessary for the hammerhead structure DNAs do not disturb it during annealing in PCR. We observed the modified DNA origami with cover DNAs by AFM.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

| GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami from Shelley F. J. Wickham et al[1]. We made three hammerhead structures from this.
(5' -> 3' direction)
| addition to staple | cover | |
|---|---|---|
| 1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
| 2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
| 3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
Experiment
October 3rd

We designed the modified origami and annealed them for about an hour in PCR. On the surface of one origami, there are 15 hammerhead structure and 1 hairpin structure. Therefore, we ordered DNA which composes the structures to replace the staple strands of the normal origami. We drew three lines on the surface using the hammerhead structures, and one line consisted of 5 hammerhead structures. The abstract design of the origami is the picture above.
October 5th
We made modified origami in October 3rd and keep them at the laboratory room temperture.
We observed the modified origami by AFM and got the clear picture of lines on the surface of the origami.
The three lines on the surface shows the fact that the modified origami which have hammerhead structures was well-done.
Also, the picture below proved that we can observe a hammerhead structure as a dot so that we can draw a picture on the origami surface. However, we couldn't not observe the hairpin. After checking, we found out that there was a mistake when we ordered the sequences, so this modified staple couldn't form an hairpin.
October 25th
The purpose of this experiment is to find out the reason why we could not observe the tablet by AFM on October 24th. To make sure whether we could not observe it because of the AFM or not, we made the modified origami which worked well on October 3rd. We made the modified origami in the same condition as that on October 3rd.
