Biomod/2012/UTokyo/UT-Komaba/Experiment/DNA Tablet: Difference between revisions
Shun Otsubo (talk | contribs) No edit summary |
|||
| (One intermediate revision by one other user not shown) | |||
| Line 55: | Line 55: | ||
===October 22nd=== | ===October 22nd=== | ||
We made modified origami | We made the modified origami on September 20th, but the origami was not structured. | ||
Therefore, we carefully made the modified staple mix again. | Therefore, we carefully made the modified staple mix again. | ||
| Line 61: | Line 61: | ||
===October 23rd=== | ===October 23rd=== | ||
We made the modified origami again and | We made the modified origami again and prepared for the observation on October 24th. | ||
[[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_23rd|More Information]] | [[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_23rd|More Information]] | ||
| Line 75: | Line 75: | ||
===October 25th=== | ===October 25th=== | ||
We prepard new staple mix of DNA tablet and made the tablet from staple mix we | We prepard new staple mix of DNA tablet and made the tablet from staple mix we used on October 20th and the tablet from staple mix we made on October 25th. | ||
Because the modified origami | Because the modified origami was well formed when we kept it at room temperature, we decided to keep both tablets at room temperature, about 20°C. | ||
Of course, there is possibility that we made some mistakes while making staple mix | Of course, there is the possibility that we made some mistakes while making the staple mix on October 20th so that the tablet was not well structured. Just in case, we kept one tube of the tablet made from staple mix on October 25th at 4°C. | ||
The purpose of the experiment is to observe the completely structured DNA tablet. | The purpose of the experiment is to observe the completely structured DNA tablet. | ||
We annealed them from 90°C to 20°C | We annealed them from 90°C to 20°C over 2800 seconds. | ||
[[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_25th|More Information]] | [[Biomod/2012/UTokyo/UT-Komaba/Experiment/Lab_Notes#October_25th|More Information]] | ||
| Line 86: | Line 86: | ||
===October 26th=== | ===October 26th=== | ||
We observed the DNA tablet which was made from staple mix served in October 25th and kept | We observed the DNA tablet which was made from staple mix served in October 25th and kept at room temperature. | ||
We could clearly observe the main body of the DNA tablet. | We could clearly observe the main body of the DNA tablet. | ||
| Line 92: | Line 92: | ||
After observing the main body of the tablet, we put cover DNA so that the body shows two pictures, | After observing the main body of the tablet, we put cover DNA so that the body shows two pictures, depending on which cover DNA we use. | ||
| Line 102: | Line 102: | ||
We could observe the sentence "I♡DNA" and the character, Tablet Boy on the surface of the tablet. | We could observe the sentence "I♡DNA" and the character, Tablet Boy on the surface of the tablet. | ||
Therefore, we could make sure that the tablet shows two pictures, and which picture it show depends on what cover DNA we put on its surface. | Therefore, we could make sure that the tablet shows two pictures, and which picture it show depends on what cover DNA we put on its surface. | ||
__NOEDITSECTION__ | |||
Latest revision as of 09:22, 28 October 2012
<html>
<style type="text/css"> </style>
</html>
Concept

The last but most important experiment is the experiment of the DNA tablet. If we combine the modified origami and bistable system, we can realize the DNA tablet. The purpose of the experiment is to observe the surface of the tablet and make sure that the surface change when we put another kind of DNA.
Method
Pseudo-hammerhead Structure
To make hammerhead structure, we needed to add some DNA sequences to existing staples witch didn't interact with other parts of DNA origami. We made such sequences from the sequence below.

| GGAACCTCAGCCCAACTAACAT |
This sequence is known not to interact with other parts of DNA origami from Shelley F. J. Wickham et al[1]. We made three hammerhead structures from this.
(5' -> 3' direction)
| addition to staple | cover | |
|---|---|---|
| 1 | CTCCAAGGTTT - TTTAGCCCAAC | GAGGTTCCTCGGGTTG |
| 2 | CGACTCCATTT - TTTCCAACTAA | TGGGCTGATGATTGTA |
| 3 | ACCCGACTTTT - TTTACTAACAT | GCTGAGGTGGTTGATT |
The Design of the DNA Tablet
Using the three types of hammerhead structures, we designed the DNA origami. We used a hairpin structure at the corner because we didn't have enough space to make a hammerhead structure there.

Experiment
October 20th
We got the modified staples, so we made the staple mix for the main body of DNA tablet and tried observing it. In this experiment, we did not put cover DNA for hammerhead structures so that we might not observe pictures on the surface. However, DNA origami wasn't observed clearly.
October 22nd
We made the modified origami on September 20th, but the origami was not structured. Therefore, we carefully made the modified staple mix again.
October 23rd
We made the modified origami again and prepared for the observation on October 24th.
October 24th
We observed the DNA tablet by AFM at the Komaba Campus. However, we could not get good pictures of the tablets from any tubes. From the pictures, the tablet seemed to not be well structured and partly collapsed.
October 25th
We prepard new staple mix of DNA tablet and made the tablet from staple mix we used on October 20th and the tablet from staple mix we made on October 25th. Because the modified origami was well formed when we kept it at room temperature, we decided to keep both tablets at room temperature, about 20°C. Of course, there is the possibility that we made some mistakes while making the staple mix on October 20th so that the tablet was not well structured. Just in case, we kept one tube of the tablet made from staple mix on October 25th at 4°C. The purpose of the experiment is to observe the completely structured DNA tablet. We annealed them from 90°C to 20°C over 2800 seconds.
October 26th
We observed the DNA tablet which was made from staple mix served in October 25th and kept at room temperature. We could clearly observe the main body of the DNA tablet.
After observing the main body of the tablet, we put cover DNA so that the body shows two pictures, depending on which cover DNA we use.
We could observe the sentence "I♡DNA" and the character, Tablet Boy on the surface of the tablet. Therefore, we could make sure that the tablet shows two pictures, and which picture it show depends on what cover DNA we put on its surface.