BME103:W930 Group5: Difference between revisions
| Line 22: | Line 22: | ||
=LAB 1 WRITE-UP= | =LAB 1 WRITE-UP= | ||
==Initial Machine Testing== | ==Initial Machine Testing== | ||
Revision as of 23:01, 9 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing.
The Original Design
When the LCD screen was unplugged from the Open PCR brains Board, the feeder information was no longer available on the screen. When we unplugged the white wire that connects the brain board to the 16 tube PCR block, the machine temperature was unable to be regulated.
The initial test date of the Open PCR Machine was October 24, 2012. Our experience with the machine was rather time consuming, with the experiment taking an hour and a half to complete. However, the machine was very straightforward and easy to use.
ProtocolsPolymerase Chain Reaction The Polymerase Chain Reaction is a process controlled by thermal cycling; a system of repeatedly heating and cooling the sample. It is simple and inexpensive, as PCR allows you to make millions of copies of DNA to better analyze data. First you need a small amount of DNA and a small amount of some PCR reaction mix. A program on the machine needs to be created consisting of three stages. During the three stages, the DNA is first heated to separate the DNA double helix, creating two single stranded DNA molecules. The thermal cycler is now cooled and primers match up to the DNA strands before they naturally attempt to pair up. As the cycles progress, DNA is replicated and used as a template to create additional copies.
There are several components of a PCR reaction. The template DNA amplifies millions of copies to determine if they are cancerous. The many primers start the binding of complentary strands (specific primers) and they bind to cancer sequences. The taq polymerase is a protein that catalyzes the DNA assembly. There is also a cofactor, which binds to Taq to enable optimal binding speed. Lastly, there are deoxynucleotide tri-phosphates, which builds a new strand of DNA. Steps to Describe How to Amplify a Patient's DNA Sample: Step 2: Heat Denaturation Step 3: Primer Annealing Step 4: Primer Extension Step 5: Termination
Flourimeter Measurements (Add your work from Week 3, Part 2 here)
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology CHEK 2, code rs17879961, is a single nucleotide polymorphism (SNP) that is linked to cancer. It is a symbol for CHK2 Checkpoint Homolog and is located on chromosome 22. Mutations of the CHEK2 gene are related to increased risk of breast cancer. In week three's class, it was concluded that PCR can be used to bind specific DNA primers to the cancerous DNA bases--resulting in cancerous DNA amplification. As a result, the PCR reaction will form normal DNA sequences and the supposed cancerous CHEK2 strain. Possible primers for supposed amplification were used in the experiment and were compared to sample sequences to determine if the DNA in question was amplified. Extra information: Gene missense, T mutates to cancer associated C for the specific allele. Cancer sequence binding primer: AACTCTTACACTGCATACAT
Results
| |||||||||||||||||||||||||||||||||||||||||||||||||||




