BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
| Line 42: | Line 42: | ||
'''Polymerase Chain Reaction'''<br> | '''Polymerase Chain Reaction'''<br> | ||
DNA is a useful health marker and can predict the likelihood that a patient has cancer, but the molecule is often available only in minute quantities. Polymerase chain reaction (PCR) is a process that amplifies minute quantities of DNA in order to obtain a sufficient number of samples for analysis. During PCR, the double helix structure is unzipped to expose the bases. DNA primer is added to the DNA solution and binds to the gene that causes cancer. An enzyme called Taq polymerase, originally found in thermophilic bacteria, catalyzes the extension of the synthetic DNA molecule. Because a non-cancer gene has a different nucleotide sequence from the cancer gene, the primer will not be able to attach to the exposed bases, so the DNA cannot be amplified. DNA amplification involves a sequence of steps called thermal cycling.<br> | |||
'''Thermal Cycling'''<br> | |||
1. First, the DNA solution was heated at 95°C for 30 seconds.<br> | |||
2. During denaturing, the temperature was held at a constant 95°C for an additional 30 seconds to allow break the hydrogen bonds between the complementary bases in the DNA molecules.<br> | |||
3. During annealing, the temperature was decreased to 55°C for 30 seconds to allow the specific primers to attach to the region of DNA encoding the cancer gene.<br> | |||
4. During extension, the temperature was increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand.<br> | |||
5. The temperature was decreased to 20°C during the final hold.<br> | |||
6. To obtain a sufficient number of samples, the process was repeated 30 times.<br> | |||
'''Components of the PCR master mix'''<br> | |||
• 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)<br> | • 2X Colorless Go Taq ® Reaction Buffer (pH 8.5)<br> | ||
• 400μM dATP<br> | • 400μM dATP<br> | ||
| Line 59: | Line 58: | ||
• 400μM dCTP<br> | • 400μM dCTP<br> | ||
• 400μM dTTP<br> | • 400μM dTTP<br> | ||
• 3mM | • 3mM MgCl<sub>2</sub><br> | ||
'''Reagent and Volume of DNA Solution''' | |||
{| {{table}} | {| {{table}} | ||
| align="center" style="background:#f0f0f0;"|'''Reagent''' | | align="center" style="background:#f0f0f0;"|'''Reagent''' | ||
| Line 74: | Line 73: | ||
| GoTaq master mix||25.0μL | | GoTaq master mix||25.0μL | ||
|- | |- | ||
| | | dH<sub>2</sub>O||23.9μL | ||
|- | |- | ||
| Total Volume||50.0μL | | Total Volume||50.0μL | ||
|} | |}<br> | ||
'''Description of DNA Samples’’’<br> | |||
Positive Control <br> | Positive Control <br> | ||
Cancer DNA template <br> | Cancer DNA template <br> | ||
Patient 1<br> | Patient 1<br> | ||
| Line 125: | Line 122: | ||
'''Flourimeter Measurements'''<br> | '''Flourimeter Measurements'''<br> | ||
[[Image:Fluorimeter Group1.jpg|thumb|left| | [[Image:Fluorimeter Group1.jpg|thumb|left|600x300px|]]<br> | ||
Flourimeter Assembly and Experiment | '''Flourimeter Assembly and Experiment Procedure'''<br> | ||
1. The box was assembled by removing the lid and unbuttoning one of its sides.<br> | 1. The box was assembled by removing the lid and unbuttoning one of its sides.<br> | ||
2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.<br> | 2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.<br> | ||
| Line 138: | Line 135: | ||
9. Steps 3-8 were repeated with the remaining DNA samples.<br><br> | 9. Steps 3-8 were repeated with the remaining DNA samples.<br><br> | ||
ImageJ Procedure<br> | '''ImageJ Procedure'''<br> | ||
1. When each photograph was taken, it was automatically saved into the memory of the smartphone.<br> | 1. When each photograph was taken, it was automatically saved into the memory of the smartphone.<br> | ||
2. After all of the photographs had been taken, all of the images were attached to an email and sent to a computer that operated the ImageJ program.<br> | 2. After all of the photographs had been taken, all of the images were attached to an email and sent to a computer that operated the ImageJ program.<br> | ||
Revision as of 07:55, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAM
LAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections Test Run
ProtocolsPolymerase Chain Reaction Thermal Cycling Components of the PCR master mix Reagent and Volume of DNA Solution
Description of DNA Samples’’’ Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedure ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%. (BONUS points: Use a program like Powerpoint, Word, Illustrator, Microsoft Paint, etc. to illustrate how primers bind to the cancer DNA template, and how Taq polymerases amplify the DNA. Screen-captures from the OpenPCR tutorial might be useful. Be sure to credit the source if you borrow images.)
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




