BME103:W930 Group1: Difference between revisions
Kevin M. Chu (talk | contribs) |
Kevin M. Chu (talk | contribs) |
||
| Line 48: | Line 48: | ||
'''Thermal Cycling'''<br> | '''Thermal Cycling'''<br> | ||
1. First, the DNA solution was heated at 95°C for 30 seconds.<br> | 1. First, the DNA solution was heated at 95°C for 30 seconds.<br> | ||
2. During denaturing, the temperature was held at a constant 95°C for an additional 30 seconds to | 2. During denaturing, the temperature was held at a constant 95°C for an additional 30 seconds to break the hydrogen bonds between the complementary bases in the DNA molecules.<br> | ||
3. During annealing, the temperature was decreased to 55°C for 30 seconds to allow the specific primers to attach to the region of DNA encoding the cancer gene.<br> | 3. During annealing, the temperature was decreased to 55°C for 30 seconds to allow the specific primers to attach to the region of DNA encoding the cancer gene.<br> | ||
4. During extension, the temperature was increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand.<br> | 4. During extension, the temperature was increased to 72°C for one minute to allow Taq DNA polymerase to bind deoxynucleoside triphosphates (dNTPs) on the template DNA, lengthening the synthetic strand.<br> | ||
5. The temperature was decreased to 20°C during the final hold.<br> | 5. The temperature was decreased to 20°C during the final hold.<br> | ||
6. To obtain a sufficient number of samples, the process was repeated 30 times.<br> | 6. To obtain a sufficient number of DNA samples, the entire process was repeated 30 times.<br> | ||
'''Components of the PCR master mix'''<br> | '''Components of the PCR master mix'''<br> | ||
| Line 129: | Line 129: | ||
1. The box was assembled by removing the lid and unbuttoning one of its sides.<br> | 1. The box was assembled by removing the lid and unbuttoning one of its sides.<br> | ||
2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.<br> | 2. Then, the box was placed upside down onto the lid, and the unbuttoned flap was lifted up. This created a dark environment that would allow for accurate measurements of the fluorescence of SYBR green dye.<br> | ||
3. Sample A was pipetted onto the slide. Because the slide is superhydrophobic, a drop formed.<br> | 3. Sample A was pipetted onto the slide. Because the slide is superhydrophobic, a drop formed on its surface.<br> | ||
4. Then, the slide was placed on the fluorimeter and adjusted so that the light fluoresced through the sample.<br> | 4. Then, the slide was placed on the fluorimeter and adjusted so that the light fluoresced through the sample.<br> | ||
5. The superhydrophobic slide and its stand were placed near the back of the dark interior of the box.<br> | 5. The superhydrophobic slide and its stand were placed near the back of the dark interior of the box.<br> | ||
| Line 139: | Line 139: | ||
'''ImageJ Procedure'''<br> | '''ImageJ Procedure'''<br> | ||
1. When each photograph was taken, it was automatically saved into the memory of the smartphone.<br> | 1. When each photograph was taken, it was automatically saved into the memory of the smartphone.<br> | ||
2. After all of the photographs | 2. After all of the photographs were taken, all of the images were attached to an email and sent to a computer that operated the ImageJ program.<br> | ||
3. The email was received by the computer, and the file containing the image was downloaded by right-clicking on the file and opening with ImageJ.<br> | 3. The email was received by the computer, and the file containing the image was downloaded by right-clicking on the file and opening with ImageJ.<br> | ||
Revision as of 08:14, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design Experimenting With the Connections Test Run
ProtocolsPolymerase Chain Reaction Thermal Cycling Components of the PCR master mix Reagent and Volume of DNA Solution
Description of DNA Samples’’’ Patient 1 Patient 1 Patient 1 Patient 2 Patient 2 Patient 2
Flourimeter Assembly and Experiment Procedure ImageJ Procedure
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The primer sequence of the single nucleotide polymorphism (SNP) that is linked to colorectal cancer is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCAGAGTGGC. The gene being affected is CHK2 (checkpoint kinase 2). The allele change is from T to C, which signifies the cancer sequence. The cancer sequence-binding primer, or the reverse primer, is AACTCTACA[C]TGCATACAT. The coordinate of the cancer base pair "C" is at 29,121,087 of the DNA sequence. 20 base pairs (bp) to the left of the cancer sequence was TA, which occurred at coordinate 29,121,067. Baye's reasoning and statistical formulas can be applied to find the link between the development of cancer and the presence of the cancer gene. In a sample size of 180 patients, 1.1% of contained a single copy of the colorectal cancer (CRC) gene in their DNA (C/T) and 98.9% had no copy of the cancer gene (T/T). According to Baye's rule, the probability of having cancer and also expressing the "C" cancer gene is 1.1% when the probability of expressing the "C" gene and also having cancer is 7.8%, the probability of having cancer is unknown, and standard probability of having cancer over the population is 5.3%. Therefore, the probability of having cancer with the "C" gene is 0.74%.
Results
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




