BME103:W930 Group4: Difference between revisions
| (4 intermediate revisions by the same user not shown) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image: | | [[Image:Renaad_Alawi.jpg|100px|thumb|Name: Renaad Alawi<br>Experiemental Protocol Planner]] | ||
| [[Image:Lauren_Allison.jpg|100px|thumb|Name: Lauren Allison<br>Research and Development]] | | [[Image:Lauren_Allison.jpg|100px|thumb|Name: Lauren Allison<br>Research and Development]] | ||
| [[Image:Jake_Krammer.jpg|100px|thumb|Name: Jake Krammer<br>Open PCR Machine]] | | [[Image:Jake_Krammer.jpg|100px|thumb|Name: Jake Krammer<br>Open PCR Machine]] | ||
| Line 98: | Line 98: | ||
<br>''Fluorimeter Assembly Procedeure:''<br> | <br>''Fluorimeter Assembly Procedeure:''<br> | ||
1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br> | 1)Use multiple pipettes to put two drops of dye and two drops of the sample on a glass slide.<br> | ||
2) | 2)label each pipette so that you don't use the same one for each sample.<br> | ||
3)Place the glass slide on the device.<br> | 3)Place the glass slide with th drops on the device.<br> | ||
4)Turn on the blue LED light.<br> | 4)Turn on the blue LED light.<br> | ||
5)Place the smartphone on the holder provided and position them in front of the device.<br> | 5)Place the smartphone on the holder provided and position them in front of the device.<br> | ||
6)Place a box on top of the device and smartphone to create a dark environment.<br> | 6)Place a box on top of the device and smartphone to create a dark environment.<br> | ||
7)Take a close clear picture of the drop.<br> | 7)Take a close clear picture of the drop.<br> | ||
8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the | 8)Make sure the pictures are clear by turning off the flash and placing the smartphone holder as close as possible to the devicelso make sure the phone is at the same position each time.<br> | ||
<br> ''Opening Images in Image J:'' <br> | <br> ''Opening Images in Image J:'' <br> | ||
Revision as of 18:45, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UP(Please finish by 11/7/2012) Initial Machine TestingThe Original Design Experimenting With the Connections When the mounting plate was unplugged from the circuit board, the machine the LCD light and the menu on the PCR machine shut off. When the white wire that connects the circuit board to the sample holder was unplugged, the temperature on the menu on the PCR machine dropped from room temperature to -40.0 degrees Celsius. The conclusion is that the white wire was the temperature sensor wire.
ProtocolsPolymerase Chain Reaction The Polymerase Chain Reaction works by amplifying DNA through the use of a PCR machine and therefore producing a multitude of copies of DNA sequences. These copies can then be further studied to diagnose hereditary and infectious diseases, such as cancer and HIV.
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology What is the function of each component of a PCR reaction? Template DNA: A double-stranded segment of DNA that encodes either a cancerous gene or a normal gene Primers: Short segments of DNA that bind to a specific sequence of nucleotides (binds to cancer gene) Taq Polymerase: A protein that serves as the catalyst for the DNA replication; grabs extra nucleotides within the solution and binds them to the "unzipped" strands Magnesium Chloride: A cofactor that binds to the Taq Polymerase and affects the speed of the reaction; positive correlation between amount of magnesium chloride and reaction speed dNTP's: Deoxynucleotide triphosphates; extra nucleotide bases in solution that are able to be grabbed and synthesized by Taq Polymerase to replicate DNA strands beyond the primer sequence
• At 95° Celsius: DNA melts and "unzips" to create two one-stranded strips, primers are added to the solution • At 57°Celsius: Primers attach to the corresponding template sequence they complement, forming one forward primer and one reverse primer • At 72° Celsius: Taq Polymerase finishes the replication process with the use of dNTP's and magnesium chloride
Why does a cancer gene produce a positive result while a normal gene produces a negative? • Because the cancer gene has the specific sequence of nucleotides that the primers can bond to, the process can continue and the DNA can be replicated; however, since the normal gene does not include that specific sequence, the primers can never bond to the strands and the process cannot take place. Specific to this cancer gene: The reverse primer that should bond to the cancer gene is AACTCTTACACTGCATACAT. The forward primer that should bond to the cancer gene is GTATAAGACATTCCTGTCCT (200 bp away from reverse)
In order to achieve accuracy of the amplification process as an actual determinant for cancer, Bayes' Rule must be used. This will compute the probability of true positives in coordination with false positives and false negatives to give a realistic prediction for how reliable the PCR process is in detecting the true cancer patients. Specific to this cancer gene: Approximately 1.1% of people have the C/T variation p (hc|C) = p(C|hc) p(hc) / p(C) where p(C)=5% and p(hc|C)=7.8%
Image Credit to OpenPCR.org/use-it/
Results
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||







