BME103:W930 Group10: Difference between revisions
| (47 intermediate revisions by 8 users not shown) | |||
| Line 13: | Line 13: | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image: | | [[Image:Susansajadi.jpg|100px|thumb|Name: Susan Sajadi<br>Role(s): Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:RaymondFeliciano.png|100px|thumb|Name: Raymond Feliciano<br>Role(s): Open PCR Machine Engineer]] | ||
| [[Image: | | [[Image:Brit.jpg|100px|thumb|Name: Britny Sepulveda<br>Role(s): Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:rachellundeen.jpg|100px|thumb|Name: Rachel Lundeen<br>Role(s): R&D Scientist]] | ||
|- valign="top" | |- valign="top" | ||
| [[Image: | | [[Image:openwetwareliz.jpg|100px|thumb|Name: Elizabeth Lopez<br>Role(s): Experimental Protocol Planner]] | ||
| [[Image: | | [[Image:science.jpg|100px|thumb|Name: Larry Moss<br>Role(s): R&D Scientist]] | ||
| [[Image: | | [[Image:Colin.jpg|100px|thumb|Name: Collin Siguenza <br>Role(s): R&D Scientist]] | ||
| [[Image: | | [[Image:Rotem.jpg|100px|thumb|Name: Rotem Berger<br>Role(s): Experimental Protocol Planner]] | ||
|} | |} | ||
| Line 31: | Line 31: | ||
'''The Original Design'''<br><center> | '''The Original Design'''<br><center> | ||
[[Image: | [[Image:pcrmachine.jpg]]</center><br> | ||
This is the OpenPCR machine utilized to automate polymerase chain reactions. This reaction allows for the amplification of specific DNA which is useful for detecting different markers, such as those indiciating an increased risk for cancer, presence of HIV, etc. | This is the OpenPCR machine utilized to automate polymerase chain reactions. This reaction allows for the amplification of specific DNA which is useful for detecting different markers, such as those indiciating an increased risk for cancer, presence of HIV, etc. | ||
| Line 43: | Line 43: | ||
'''Test Run''' | '''Test Run''' | ||
On Oct. 24th, 2012, we first used the Open PCR machine to run 25 cycles on eight samples which included two sets of three samples and a positive and negative control. The process was successful, taking about 90 minutes for the reaction to complete. Initial testing of the device indicated that the machine and software were synced in regards to the temperature during each cycle.<br> | On Oct. 24th, 2012, we first used the Open PCR machine number 10 to run 25 cycles on eight samples which included two sets of three samples and a positive and negative control. The process was successful, taking about 90 minutes for the reaction to complete. Initial testing of the device indicated that the machine and software were synced in regards to the temperature during each cycle.<br> | ||
| Line 53: | Line 53: | ||
'''Polymerase Chain Reaction'''<br> | '''Polymerase Chain Reaction'''<br> | ||
Polymerase Chain Reaction(PCR) works by using a mix of enzymes that transcribe sections of DNA. The enzyme mix is combined with patient DNA. Then, the sample is heated and cooled in regular cycles to match the ideal temperatures for the different enzymes. This will result in replication of the specific section of DNA that is being tested. | |||
Steps to amplify a patient's DNA sample: | |||
1. Add 50 microliters PCR master mix of enzymes to patient DNA sample | |||
2. Put in PCR machine | |||
3. Run for 25 cycles at 95 degrees C for 30 seconds, 57 degrees C for 30 seconds, and 72 degrees C for 30 seconds <br> | |||
{| | |||
| align="center" style="background:#f0f0f0;"|'''Reagent''' | |||
| align="center" style="background:#f0f0f0;"|'''Volume''' | |||
|- | |||
| Template DNA (20 ng)||0.2 μL | |||
|- | |||
| 10 μM forward primer||1.0 μL | |||
|- | |||
| 10 μM reverse primer||1.0 μL | |||
|- | |||
| GoTaq master mix||50.0 μL | |||
|- | |||
| dH2O||47.8 μL | |||
|- | |||
| Total Volume||100.0 μL | |||
|} | |||
<br> | <br> | ||
Positive Control:<br> | |||
cancer DNA template <br> | |||
Negative Control: <br> | |||
no DNA template <br> | |||
Patient 1:<br> | |||
ID 29013 <br> | |||
Replicate 1 <br> | |||
Tube Label: O1<br> | |||
Patient 1:<br> | |||
ID 29013 <br> | |||
Replicate 2<br> | |||
Tube Label: O2<br> | |||
Patient 1:<br> | |||
ID 29013 <br> | |||
Replicate 3<br> | |||
Tube Label: O3 | |||
Patient 2: <br> | |||
ID 13146 <br> | |||
Replicate 1 <br> | |||
Tube Label: delta 1<br> | |||
Patient 2: <br> | |||
ID 13146 <br> | |||
Replicate 2 <br> | |||
Tube Label: delta 2<br> | |||
Patient 2: <br> | |||
ID 13146 <br> | |||
Replicate 3 <br> | |||
Tube Label: delta 3<br> | |||
'''Fluorescent Measurements'''<br> | '''Fluorescent Measurements'''<br> | ||
Flourimeter Setup: <br> | |||
1. Place the glass slide onto the device.<br> | |||
2. Turn on the blue light and move the slide to have the light positioned between two of the dots on the slide.<br> | |||
3. Place two drops of the dye and two drops of the samples spread over two of the dots on the slide. Make sure drops are placed over two dots vertically '''not''' horizontally or side by side.<br> | |||
4. Place the phone in the holder close enough to the device to get a close picture.<br> | |||
5. Place the box over the device and phone holder.<br> | |||
6. Close the box as much as possible and take picture. | |||
Camera Setting: The camera had the flash off, ISO at 800, auto white balance, high exposure, high saturation, and low contrast. | |||
ImageJ Procedure: <br> | |||
1. Open up the image.<br> | |||
2. Go to Set Measurement under the tab analyze, and select area, integrated density, and mean grey value. After doing this once, the setting should remain the same.<br> | |||
3. Split the channels, by going under the tab Image, and then Color. This will split the file into three files, one of which will be labeled as a green channel. <br> | |||
4. Select the green image and then select the oval selection tool. <br> | |||
5. Draw an oval around the droplet in the image and select Measure under the Analyze tab. <br> | |||
6. The same oval can me moved to the background of the image. Then select Measure. <br> | |||
7. Record all values, or save them as an excel file in ImageJ. <br> | |||
8. Repeat all steps for each image. <br> | |||
| Line 70: | Line 135: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
The NCBI database allows for genes to be searched through in order to determine different mutations and information about them. In this lab, we looked up CHEK2 | The NCBI database allows for genes to be searched through in order to determine different mutations and information about them. In this lab, we looked up CHEK2 as it related to rs17879961, a human gene, in the Short Genetic Variations database. CHEK2 is checkpoint kinase 2 which happens in response to DNA damage. Through the database, it was found that a missense mutation occured in the 22nd chromosome. The primer of the cancer sequence is | ||
The | |||
<center><code>GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGC</code></center> | |||
and the reverse primer to this would be | |||
<center>[[Image:taqpolymer.jpg]]</center> | <center><code>AACTCTTAC'''ACT'''GCATACAT.</code> </center> | ||
The mutation for cancer changes the codon "ATT" to "ACT" in the DNA sequence. This change codes for cancers such as breast and colorectal cancer. | |||
The reason why cancer mutations give a positive PCR signal, while a non-cancer sequence gives no signal, is a result of the primer that attaches to the sequence. The primer is coded for the specific codon "ACT" and will only attach if the sequence is such, which then allows the Taq Polymerase to bind and replicate the DNA exponentially. If the primer sees that the codon is "ATT," it will not bind and therefore will not replicate and cause the PCR signal to be positive. In this lab, the samples that exhibited the fluorescent dye were the ones in which the PCR signal was positive and therefore had cancer. | |||
Baye's Rule is used to determine the probability that a person has cancer or not. In a study of 180 people, 1.1% have the mutation for cancer while 98.9% do not. Using Baye's rule, it was found that 7.8% should have cancer. The formula for Baye's Rule is p (hc|C) = p(C|hc) p(hc) / p(C) <br> | |||
<center>http://www.eecs.qmul.ac.uk/~norman/BBNs/image/BBNs0050.gif</center> | |||
<center>[[Image:group10pcr.jpg]][2]</center> | |||
<center>[[Image:taqpolymer.jpg]][1]</center> | |||
For an animated walkthrough of the process, check out this [http://learn.genetics.utah.edu/content/labs/pcr/PCR%20Biotechnique.swf PCR Virtual Lab] from the team at the University of Utah's [http://learn.genetics.utah.edu/content/labs/pcr/ Genetic Science Learning Center] | For an animated walkthrough of the process, check out this [http://learn.genetics.utah.edu/content/labs/pcr/PCR%20Biotechnique.swf PCR Virtual Lab] from the team at the University of Utah's [http://learn.genetics.utah.edu/content/labs/pcr/ Genetic Science Learning Center] | ||
==Results== | ==Results== | ||
| Line 150: | Line 219: | ||
<table border="1" cellspacing="1"> | <table border="1" cellspacing="1"> | ||
<tr> | <tr> | ||
<td> Sample ID | <td> Sample ID </td> <td> INTDEN with background subtracted </td> | ||
</tr> | </tr> | ||
<p></p> | <p></p> | ||
| Line 156: | Line 225: | ||
<p></p> | <p></p> | ||
<tr> | <tr> | ||
<td></td><td></td> <td></td> <td></td> <td></td> | <td>110927</td><td>18189273</td> | ||
</tr> | |||
<tr> | |||
<td>110501</td> <td>3359324 </td> | |||
</tr> | |||
<tr> | |||
<td>1110252</td> <td>3219375 </td> | |||
</tr> | |||
<tr> | |||
<td>110052</td> <td>2390746 </td> | |||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td></td> <td> | <td>105842</td> <td>1570398 </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td></td> <td> | <td> 11121</td> <td>420024 </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td></td> <td> | <td>111314 </td> <td>343814 </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td></td> <td> </td> <td> </td> <td> </td> <td> </td> | <td> 1115585</td> <td>621665 </td> | ||
</tr> | |||
</table></centeR> | |||
<hr> | |||
<!--- Place two small Image J data images here. One showing the result of Water and the other showing the result of Calf Thymus DNA ---> | |||
<center> | |||
Green Channel With DNA | |||
[[Image:GreenchannelwithDNAgroup10.jpg]] | |||
Green Channel With Water | |||
[[Image:Greenchannelwithwatergroup10.jpg ]] | |||
</center> | |||
<hr> | |||
<center> | |||
<b> Data Measured via ImageJ </b> | |||
<table border="1" cellspacing="1"> | |||
<tr> | |||
<td> Sample ID </td> <td>Drop 1 </td> <td><center> Drop 2 <br></center></td> | |||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> </td> | <td>110927 </td><td> dye</td> <td> 01</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> | <td>110501</td> <td>dye </td> <td>delta 3 </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> | <td>105538</td> <td>dye </td> <td>water</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> | <td>1110252</td> <td>dye </td> <td>delta 2 </td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> | <td>110052 </td><td>dye </td> <td> delta 1</td> | ||
</tr> | </tr> | ||
<tr> | <tr> | ||
<td> </td> <td> </td> <td> | <td>105842</td> <td>dye </td> <td>negative control </td> | ||
</tr> | </tr> | ||
</ | <tr> | ||
<td>11121 </td> <td>dye </td> <td>02</td> | |||
</tr> | |||
< | <tr> | ||
<td> 111314</td> <td> dye</td> <td>03 </td> | |||
</tr> | |||
<tr> | |||
<td> 1115585</td> <td>dye </td> <td>DNA standard </td> | |||
</tr> | |||
</table></centeR> | |||
<!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | <!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | ||
| Line 220: | Line 332: | ||
KEY | KEY | ||
* '''Sample''' = | * '''Sample''' = The sample is the given DNA which may or may not contain the codon for cancer. | ||
* '''Integrated Density''' = | * '''Integrated Density''' = The integrated density is the sum of the values of pixels in an area. The integrated density in this lab can be found by subtracting the integrated density of the background from the integrated density of the samples. | ||
* '''DNA μg/mL''' = <!--- how you calculated this ---> | * '''DNA μg/mL''' = <!--- how you calculated this ---> | ||
* '''Conclusion''' = | * '''Conclusion''' = The fluorescence test showed whether or not the samples had the codon for cancer. If the sample glowed, then it had the cancer, but if it did not glow, it did not have the cancer gene. | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | |||
|} | |||
==Works Cited== | |||
[1] "Microbial Chatter." - Thermus Aquaticus. N.p., n.d. Web. 31 Oct. 2012. <http://docp.edublogs.org/thermus-aquaticus/>. | |||
< | [2] "Replication." Shmoop. N.p., n.d. Web. 31 Oct. 2012. <http://www.shmoop.com/dna/dna-replication.html>. | ||
Latest revision as of 22:49, 14 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 1 WRITE-UPInitial Machine Testing![]() This is the OpenPCR machine utilized to automate polymerase chain reactions. This reaction allows for the amplification of specific DNA which is useful for detecting different markers, such as those indiciating an increased risk for cancer, presence of HIV, etc. Experimenting With the Connections When we unplugged the LCD screen from the Open PCR circuit board, the machine's LCD screen did not turn on. When we unplugged the white wire that connects Open PCR circuit board to the heat sink, there appeared to be no effect, however, it is likely that the heat sink would not function during a trial.
On Oct. 24th, 2012, we first used the Open PCR machine number 10 to run 25 cycles on eight samples which included two sets of three samples and a positive and negative control. The process was successful, taking about 90 minutes for the reaction to complete. Initial testing of the device indicated that the machine and software were synced in regards to the temperature during each cycle.
ProtocolsPolymerase Chain Reaction Polymerase Chain Reaction(PCR) works by using a mix of enzymes that transcribe sections of DNA. The enzyme mix is combined with patient DNA. Then, the sample is heated and cooled in regular cycles to match the ideal temperatures for the different enzymes. This will result in replication of the specific section of DNA that is being tested. Steps to amplify a patient's DNA sample: 1. Add 50 microliters PCR master mix of enzymes to patient DNA sample 2. Put in PCR machine 3. Run for 25 cycles at 95 degrees C for 30 seconds, 57 degrees C for 30 seconds, and 72 degrees C for 30 seconds
Flourimeter Setup: Camera Setting: The camera had the flash off, ISO at 800, auto white balance, high exposure, high saturation, and low contrast. ImageJ Procedure:
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology The NCBI database allows for genes to be searched through in order to determine different mutations and information about them. In this lab, we looked up CHEK2 as it related to rs17879961, a human gene, in the Short Genetic Variations database. CHEK2 is checkpoint kinase 2 which happens in response to DNA damage. Through the database, it was found that a missense mutation occured in the 22nd chromosome. The primer of the cancer sequence is GGAAGTGGGTCCTAAAAACTCTTACA[C/T]TGCATACATAGAAGATCACAGTGGCand the reverse primer to this would be AACTCTTACACTGCATACAT. The mutation for cancer changes the codon "ATT" to "ACT" in the DNA sequence. This change codes for cancers such as breast and colorectal cancer.
The reason why cancer mutations give a positive PCR signal, while a non-cancer sequence gives no signal, is a result of the primer that attaches to the sequence. The primer is coded for the specific codon "ACT" and will only attach if the sequence is such, which then allows the Taq Polymerase to bind and replicate the DNA exponentially. If the primer sees that the codon is "ATT," it will not bind and therefore will not replicate and cause the PCR signal to be positive. In this lab, the samples that exhibited the fluorescent dye were the ones in which the PCR signal was positive and therefore had cancer.
Baye's Rule is used to determine the probability that a person has cancer or not. In a study of 180 people, 1.1% have the mutation for cancer while 98.9% do not. Using Baye's rule, it was found that 7.8% should have cancer. The formula for Baye's Rule is p (hc|C) = p(C|hc) p(hc) / p(C)
[2] [1]For an animated walkthrough of the process, check out this PCR Virtual Lab from the team at the University of Utah's Genetic Science Learning Center ResultsData Measured via ImageJ
Green Channel With DNA Green Channel With Water
Data Measured via ImageJ
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Works Cited
[1] "Microbial Chatter." - Thermus Aquaticus. N.p., n.d. Web. 31 Oct. 2012. <http://docp.edublogs.org/thermus-aquaticus/>.
[2] "Replication." Shmoop. N.p., n.d. Web. 31 Oct. 2012. <http://www.shmoop.com/dna/dna-replication.html>.












