BME103:T930 Group 1: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
 
(10 intermediate revisions by 2 users not shown)
Line 12: Line 12:
|- valign="top"
|- valign="top"
| [[Image:Joseph Heath.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist & PCR Machine Engineer]]
| [[Image:Joseph Heath.jpg|100px|thumb|Joseph Heath:<br>Research & Development Scientist & PCR Machine Engineer]]
| [[Image:BME103student.jpg|100px|thumb|Jessica Kemper:<br>Experimental Protocol Planner]]
| [[Image:Jessica Kemper.jpg|100px|thumb|Jessica Kemper:<br>Experimental Protocol Planner]]
| [[Image:BME103_Group1_Maile.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]]
| [[Image:BME103_Group1_Maile.jpg|100px|thumb|Maile Ravenkamp:<br>Experimental Protocol Planner]]
| [[Image:Sexy crew.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]]
| [[Image:Sexy crew.jpg|100px|thumb|Nick Hool:<br>PCR Machine Engineer]]
Line 28: Line 28:




This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequence in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.<br>
This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequences in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.<br>




Line 49: Line 49:


'''Polymerase Chain Reaction'''<br>
'''Polymerase Chain Reaction'''<br>
The open PCR machine works by first denaturing the DNA, causing it to separate. Once that occurs, the sample is cooled at 50 to 60 degrees Celsius. Then, the samples are raised to 72°C to allow Taq DNA to extend the DNA sequences, which then creates 4 DNA strands. This occurs four more times, resulting in 32 strands of DNA. The suggested amount of cycles is 25 to 30. After the amount of cycles, the strands are separated usually during gel electrophoresis. <br>


'''Components of the PCR Master Mix''' <br>
'''Components of the PCR Master Mix''' <br>
Line 61: Line 63:
2. Prepare the following reaction mix on ice: <br>
2. Prepare the following reaction mix on ice: <br>


[[Image:BME103_Group1_Protocol.png‎|200px|Reagents and Volumes used in PCR replication]]<br>Reagents and volumes used in PCR replication <br>
{| {{table}}
|- style="background:#f0f0f0;"
| '''Reagent''' || '''Volume'''
|-
| Template DNA (20 ng) || 0.2 µL
|-
| 10 µM forward primer || 1.0 µL
|-
| 10 µM reverse primer || 1.0 µL
|-
| GoTaq master mix || 50.0 µL
|-
| dH<sub>2</sub>O || 47.8 µL
|-
| '''Total Volume''' || 100.0 µL
|}
 


3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds. <br>
3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds. <br>
Line 83: Line 101:
'''Flourimeter Procedure'''<br>
'''Flourimeter Procedure'''<br>


1. turn on the excitation light using the switch for the Blue LED. <br>
1. Turn on the excitation light using the switch for the Blue LED. <br>
2. Place your smart phone on the cradle at a right angle from the slide. <br>
2. Place your smart phone on the cradle at a right angle from the slide. <br>
3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus. <br>
3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus. <br>
Line 98: Line 116:
[[Image:BME103_Group1_Flourimeter.jpg‎|250px|Patients and Samples]]<br>
[[Image:BME103_Group1_Flourimeter.jpg‎|250px|Patients and Samples]]<br>
'''Samples''' <br>
'''Samples''' <br>
[[Image:BME103_Group1_Samples.jpg‎|250px|Patients and Samples]]<br>Sample Labels and Patient Numbers <br>
{| {{table}}
|- style="background:#f0f0f0;"
| '''Sample Number''' || '''Patient Number''' || '''Gender''' || '''Age'''
|-
| Negative Control || N/A || N/A || N/A
|-
| Positive Control || N/A || N/A || N/A
|-
| 1R1 || 43417 || Male || 62
|-
| 1R2 || 43417 || Male || 62
|-
| 1R3 || 43417 || Male || 62
|-
| 2R1 || 11260 || Female || 47
|-
| 2R2 || 11260 || Female || 47
|-
| 2R3 || 11260 || Female || 47
|}
'''Image J Procedure'''<br>
'''Image J Procedure'''<br>
1. Search Image J in Google and then download Image J <br>
1. Search Image J in Google and then download Image J <br>
Line 113: Line 150:


==Research and Development==
==Research and Development==
'''Baye's Rule''' <br>
Baye's Rule allows one to use all data available, not only to analyze it but to also understand the limitations of tests such as cancer diagnostics.
Baye's Rule equation: p(A/B)= (p(B/A)p(A))/p(B)


'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
'''Specific Cancer Marker Detection - The Underlying Technology'''<br>
Line 163: Line 206:


==References==
==References==
"GoTaq® Colorless Master Mix (M714) Product Information." GoTaq® Colorless Master Mix Protocol. Promega, 2012. Web. 15 Nov. 2012.  <http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/>. <br>
Hunt, Margaret. "Real Time PCR Tutorial." Real Time PCR Tutorial. University of South Carolina, 10 July 2010. Web. 15 Nov. 2012. <http://pathmicro.med.sc.edu/pcr/realtime-home.htm>. <br>

Latest revision as of 17:44, 15 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help
Joseph Heath:
Research & Development Scientist & PCR Machine Engineer
Jessica Kemper:
Experimental Protocol Planner
Maile Ravenkamp:
Experimental Protocol Planner
Nick Hool:
PCR Machine Engineer
Christian Boden:
PCR Machine Engineer & Research & Development Scientist

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design


This machine is called an Open PCR machine. PCR stands for polymerase chain reaction, and this machine helps us create specific strands of DNA. It can hold 16 tubes of DNA and is compatible with any computer that has the appropriate downloaded software. The machine goes through a series of steps to recreate the DNA. First, it heats up to break apart the DNA strands. Then, it cools down to allow polymer chains to attach to the target DNA sequence. Once the primers are attached, the machine will heat up again so that the protein in charge of DNA construction will activate and bind to the polymers and then start to build the DNA sequences that are targeted. This machine is capable of replicating millions of segments of a specific DNA sequences in just an hour or two. This machine, like many others, can be improved but for standard use, this machine works fine as is. If we improve this machine, the process that the machine goes through will most likely be the same but the hardware of the Open PCR machine may be changed. For example, if we wanted to make the amount of time for each cycle shorter, we could improve the heating elements of the machine so that the heating and cooling will be faster and more effective.


Experimenting With the Connections

When we unplugged the mounting plate from the open PCR circuit board, the display screen on the PCR box did not work.

When we unplugged the white wire that connects the open PCR circuit board to the heating block, there was no temperature reading on the display screen.


Test Run

(First Open PCR test: 10/25/12. We had a successful and simple run of PCR)




Protocols

Polymerase Chain Reaction

The open PCR machine works by first denaturing the DNA, causing it to separate. Once that occurs, the sample is cooled at 50 to 60 degrees Celsius. Then, the samples are raised to 72°C to allow Taq DNA to extend the DNA sequences, which then creates 4 DNA strands. This occurs four more times, resulting in 32 strands of DNA. The suggested amount of cycles is 25 to 30. After the amount of cycles, the strands are separated usually during gel electrophoresis.

Components of the PCR Master Mix

1. Modified Taq DNA polymerase
2. dNTP's
3. MgCl2
4. reaction buffers

1. Thaw the GoTaq Colorless Master Mix at room temperature. Vortex the Master Mix, then spin it briefly in a microcentrifuge to collect the material at the bottom of the tube.

2. Prepare the following reaction mix on ice:

Reagent Volume
Template DNA (20 ng) 0.2 µL
10 µM forward primer 1.0 µL
10 µM reverse primer 1.0 µL
GoTaq master mix 50.0 µL
dH2O 47.8 µL
Total Volume 100.0 µL


3. If using a cycler without a heated lid, overlay the reaction mix with 1-2 drops of mineral oil to prevent evaporation during thermal cycling. Centrifuge the reaction mix in a microcentrifuge for 5 seconds.

4. Place the reactions in a thermal cycler that has been preheated to 95 degrees Celsius. Perform PCR.

How To Amplify A Patient's DNA Sample
1. Denaturation: a 2-minute denaturation at 95 degrees celsius.

2. Annealing: perform the reaction about 5 degrees Celsius below the calculated melting temperature of the primers and increasing the temperature in increments of 1°C to the annealing temperature; this should occur anywhere between 30 seconds and 1 minute.

3. Extension: performed between 72-74 degrees Celsius, extension allows 1 minute for every 1 kb of DNA to be amplified; the suggested time for extension is 5 minutes.

4. Refrigeration: refrigerate the tubes at 4 degrees Celsius for several hours; this will minimize the opportunity for DNA polymerase to continue to be active at higher temperatures.

5. Cycle Number: the optimal amplification is 25-30 cycles, but up to 40 may be performed.

Flourimeter Measurements

Flourimeter Procedure

1. Turn on the excitation light using the switch for the Blue LED.
2. Place your smart phone on the cradle at a right angle from the slide.
3. Turn on the camera setting on the smartphone. Turn off the flash and set the ISO to 800 or higher and increase the exposure to maximum. You should also turn off the autofocus, if possible, and make sure that you can take an image where the drop on the slide will be in focus.
4. Adjust the distance between the smartphone on its cradle and the first two rows of the slide so that it is as close as you can get without having a blurry image.
5. The pipette should be filled with liquid only to the bottom of the black line. Then, carefully place two drops of water in the middle of the first two rows of the slide using the plastic pipette. Then add two more drops. The drop should then be pinned and look like a beach ball. It should be between 130-160 μL.
6. Align the drop by moving the slide so that the blue LED light is focused by the drop to the middle of the black fiber optic fitting on the other side of the drop (you will see that it has a small opening that is used for spectral measurement).
7. Cover the fluorimeter with the light box, but make sure you can access your smartphone to take the image. The light box should be used to remove as much stray light as possible, but do not worry if you have some light.
8. Take three images of the drop of water. Do not move your smartphone.
9. Remove the box and be careful not to move your smartphone. If you want to adjust for any movement, use the ruler provided to measure the distance so that you can return to that location. You can also use ImageJ to compensate for moving the camera, but it makes the analysis more complicated.
10. Use a clean plastic pipette to remove the water drop from the surface.
11. Push the slide in so that you are now in the next set of two holes.
12. Repeat steps 5-10 four more times so that you have now imaged all 5 positions on the slide.
13. Record the type of smartphone you used, the distance from the base of smartphone cradle to measurement device, and attach one image for each position of the drop.
Patients and Samples
Samples

Sample Number Patient Number Gender Age
Negative Control N/A N/A N/A
Positive Control N/A N/A N/A
1R1 43417 Male 62
1R2 43417 Male 62
1R3 43417 Male 62
2R1 11260 Female 47
2R2 11260 Female 47
2R3 11260 Female 47

Image J Procedure
1. Search Image J in Google and then download Image J
2. Open Image J then click "file" and click "open" and open the image you want to analyze
3. Once your image is open click "analyze" and then click "set measurements" and check the boxes "area" "integrated density" and "mean gray value" leave the rest of the boxes empty
4. now click "image" then click "color" and then click "split channels"
5. This will split your image into three, you will use the one that is marked as the "green" picture, cancel the others
6. Activate the oval tool
7. draw the best oval you can around the drop and then press the control button+ the "m" key
8. Move the oval over to the background (the black around the picture) and press the control button and the m key again
9. repeat steps for all pictures
10. Save your data in an excel format by clicking "file" and then clicking "save as" then save the file with the name you want


Research and Development

Baye's Rule
Baye's Rule allows one to use all data available, not only to analyze it but to also understand the limitations of tests such as cancer diagnostics.

Baye's Rule equation: p(A/B)= (p(B/A)p(A))/p(B)


Specific Cancer Marker Detection - The Underlying Technology

The r17879961 cancer-associated sequence (AAACTCTTACACTGCATACA) will produce a DNA signal because of its nucleotide variation (ACATTGC to ACACTGC). This T-C change results in an isoleucene to threonine substitution. In a study in Finland, patients with colorectal cancer (CRC), the most common cancer associated with the DNA sequence change, had the allele 7.8% of the time while patients without CRC had the allele in 5.3% of patients, showing a significantly higher association in CRC patients.[1] PCR detection will only give a signal if this allele is present.



Results


Sample Integrated Density DNA μg/mL Conclusion
PCR: Negative Control 13908255 1.019586396 negative
PCR: Positive Control 27282151 2 positive
PCR: Patient 1 ID 43417, rep 1 35526894 2.604405642 positive
PCR: Patient 1 ID 43417, rep 2 19073943 1.398272666 positive
PCR: Patient 1 ID 43417, rep 3 29391013 2.154596461 positive
PCR: Patient 2 ID 11260 , rep 1 1903450 0.139538118 negative
PCR: Patient 2 ID 11260, rep 2 5214727 0.382281221 negative
PCR: Patient 2 ID 11260, rep 3 5099077 0.373803151 negative


KEY

  • Sample = Describes sample number and patient
  • Integrated Density = The Integrated Density of the Drop minus that of the background
  • DNA μg/mL = 2 * IntDen of Sample/IntDen of Calf Thymus
  • Conclusion = Whether exponential DNA replication has occured

References

"GoTaq® Colorless Master Mix (M714) Product Information." GoTaq® Colorless Master Mix Protocol. Promega, 2012. Web. 15 Nov. 2012. <http://www.promega.com/resources/protocols/product-information-sheets/g/gotaq-colorless-master-mix-m714-protocol/>.

Hunt, Margaret. "Real Time PCR Tutorial." Real Time PCR Tutorial. University of South Carolina, 10 July 2010. Web. 15 Nov. 2012. <http://pathmicro.med.sc.edu/pcr/realtime-home.htm>.