BME103:T930 Group 13: Difference between revisions
m →Results |
|||
| (48 intermediate revisions by 4 users not shown) | |||
| Line 9: | Line 9: | ||
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit above this line unless you know what you are doing. ##### --> | ||
= | =THE A TEAM= | ||
{| style="wikitable" width="700px" | {| style="wikitable" width="700px" | ||
|- valign="top" | |- valign="top" | ||
| [[Image:Windows Photo Gallery Wallpaper.jpg|100px|thumb|Name: Marcus Sansoni<br>Open PCR Machine Engineer]] | |||
| [[Image:Pete_Marple.jpg|100px|thumb|Name: Pete Marple<br>Experimental Protocol Planner]] | | [[Image:Pete_Marple.jpg|100px|thumb|Name: Pete Marple<br>Experimental Protocol Planner]] | ||
| [[Image:Michelle_Lipowicz.jpg|100px|thumb|Name: Michelle Lipowicz<br>Experimental Protocol Planner]] | | [[Image:Michelle_Lipowicz.jpg|100px|thumb|Name: Michelle Lipowicz<br>Experimental Protocol Planner]] | ||
| [[Image:Alen.jpg100px|100px|thumb|Name: Allen Janis<br>R&D Scientist]] | | [[Image:Alen.jpg100px|100px|thumb|Name: Allen Janis<br>R&D Scientist]] | ||
| [[Image:Ian_Bainbridge.jpg|100px|thumb|Name: Ian Bainbridge<br>R&D Scientist]] | | [[Image:Ian_Bainbridge.jpg|100px|thumb|Name: Ian Bainbridge<br>R&D Scientist]] | ||
| [[Image:Tyler.jpg|100px|thumb|Name: Tyler Barnes<br>Open PCR Machine Engineer]] | | [[Image:Tyler.jpg|100px|thumb|Name: Tyler Barnes<br>Open PCR Machine Engineer]] | ||
|} | |} | ||
| Line 27: | Line 28: | ||
'''The Original Design'''<br> | '''The Original Design'''<br> | ||
<br> | <br> https://myasucourses.asu.edu/courses/1/2012Fall-T-BME103-86053-86055-86054/groups/_185919_1//_7761026_1/NEW.jpg <br> | ||
The original machine design from the OpenPCR design team. Used as an affordable tool to amplify a DNA sequence using [http://en.wikipedia.org/wiki/Polymerase_chain_reaction Polymerase Chain Reaction.] You can find information on the OpenPCR device [http://openpcr.org here.] | The original machine design from the OpenPCR design team. Used as an affordable tool to amplify a DNA sequence using [http://en.wikipedia.org/wiki/Polymerase_chain_reaction Polymerase Chain Reaction.] You can find information on the OpenPCR device [http://openpcr.org here.] | ||
| Line 34: | Line 35: | ||
'''Experimenting With the Connections'''<br> | '''Experimenting With the Connections'''<br> | ||
To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD | To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD display from the CPU, which caused the LCD display to lose power. We also unplugged the connection between the circuit board and the main heating block. After this connection was severed the LCD displayed a reading of -40 °C. <br> | ||
<br>'''Test Run'''<br> | |||
October 25, 2012: We used machine number 11 to perform our PCR. The OpenPCR machines in the class showed lots of variation in overall run times, with our machine running on the slower side of the class average. We assume this reflected the individual machine's ability to transition between temperature cycles. The OpenPCR did finish the cycling and based on the second part of our experiment it successfully amplified our DNA sequence. | |||
| Line 55: | Line 53: | ||
<br> | <br> | ||
'''How to Amplify a Patient's DNA'''<br> | '''How to Amplify a Patient's DNA'''<br> | ||
1 | '''Step 1-''' | ||
2 | After the Patients DNA is placed in to the test tubes along with the Master Mix, the tubes are placed into the PCR machine.<br> | ||
3 | '''Step 2-''' | ||
4 | As the machine warms to almost a boil, at 95°C, the DNA strands will begin to separate. <br> | ||
5 | '''Step 3-''' | ||
Once the PCR machine has cooled down to 57°C, the primer will bind to the target sequence. <br> | |||
'''Step 4-''' | |||
The PCR machine needs to then warm back up to 72°C in order for extension of DNA to occur. This initiates the taq function where the taq protein, along with magnesium chloride, takes free floating nucleotides (DNTPs) and attaches them to the DNA stand in a reverse direction.<br> | |||
'''Step 5-''' | |||
Once steps 2-4 are repeated several times, each cycle will create newly replicated DNA stands and allow replication to continue until Master Mix is used up.<br> | |||
<br> | <br> | ||
| Line 109: | Line 112: | ||
<br> | <br> | ||
'''Flourmeter Assembly Procedure'''<br> | '''Flourmeter Assembly Procedure'''<br> | ||
1 | '''Step 1-''' | ||
2 | Unclasp the black box and place it upside down to make a shade<br> | ||
3 | '''Step 2-''' | ||
4 | Place the assembly that is holding the slide inside the box<br> | ||
5 | '''Step 3-''' | ||
6 | Use the pipette to place a little over 2 drops of sample on the slide<br> | ||
'''Step 4-''' | |||
Turn on the blue light<br> | |||
'''Step 5-''' | |||
Position the slide so that the light goes directly through the drop<br> | |||
'''Step 6-''' | |||
Place a smartphone in the stand and position it so that the drop is in the picture<br> | |||
<br> | <br> | ||
'''Saving Images to ImageJ'''<br> | '''Saving Images to ImageJ'''<br> | ||
1 | '''Step 1-''' | ||
2 | Send the pictures from the phone to the email (make sure to keep track of which picture goes to which sample)<br> | ||
3 | '''Step 2-''' | ||
4 | Open our email on the computer and download the attached pictures on to the computer's picture file<br> | ||
5 | '''Step 3-''' | ||
Open the ImageJ<br> | |||
'''Step 4-''' | |||
Click file and then click open (and the files from your computer open up)<br> | |||
'''Step 5-''' | |||
Click the desired picture and it will open up on ImageJ<br> | |||
==Research and Development== | ==Research and Development== | ||
| Line 129: | Line 143: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine | Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine and cycled through 3 stages. The first stage is done at 95°C, in this stage the DNA double helix denatures into individual single strands. The second stage is dropped to 57°C where the primers anneal to the single strand of DNA in preparation for replication. The third and final stage reheats the sample to 72°C where TAQ polymerase copies all the DNA. | ||
<br> | |||
<br> | |||
The success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: 3' TGGTATAAGACATTCCTGTC 5' and the reverse primer is: 5' AACTCTTACACTGCATACAT 3'. The reverse primer contains the specific SNP for this gene and the forward primer is 200 bp left of the reverse primer. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a thymine is replaced by a cytosine. <br> Therefore only DNA segments that match these primers will be amplified. | |||
<br> | |||
<br> | |||
This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. A positive result was detected by using an image of the DNA dyed with Sybr green dye taken in a a black box. The concentration of DNA could be detected by measuring the amount of fluorescence in the picture. | |||
<br> | |||
<br> | |||
<br> | |||
'''Bayes Rule''' | |||
<br> | |||
<br> | |||
The Bayes rule is: p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}] | |||
<br> | |||
In the specific case of these patients, 1.1% of of the population of 180 suffered from the C/T mutation leaving 98.9% with the normal gene. This mutation shows a significant link to breast and colorectal cancer as well as a susceptibility for Li-Fraumeni syndrome. A study conducted in Finland found that this mutation occurred in 7.8% the population suffering from caner and only 5.3% of people not suffering from caner. | |||
<br> | <br> | ||
<http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg> | <http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg> | ||
<br> | |||
Image credit to www.nature.com | |||
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012. | |||
<br> | |||
==Results== | ==Results== | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
! Description !! Eppendorf Tube Label !! Pipette Label | |||
|- | |- | ||
| Patient 1-Sample 1 || 1-1 || 2 | |||
|- | |- | ||
| | | Patient 1-Sample 2 || 1-2 || 3 | ||
|- | |- | ||
| | | Patient 1-Sample 3 || 1-3 || 4 | ||
|- | |- | ||
| | | Negative Control || -C || 1 | ||
|- | |- | ||
| | | Positive Control || +C || 5 | ||
|- | |- | ||
| | | Patient 2-Sample 1 || 2-1 || 6 | ||
|- | |- | ||
| | | Patient 2-Sample 2 || 2-2 || 7 | ||
|- | |- | ||
| | | Patient 2-Sample 3 || 2-3 || 8 | ||
|- | |- | ||
| Red || Red Dot || Red | |||
|-} | |||
'''DNA Sample Preparation - Step 1'''<br> | |||
This table describes the procedural steps taken to prepare our samples for the fluorimeter. | |||
<br> | <br> | ||
<br> | <br> | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
! Image Number !! Drop 1 !! Drop 2 !! Comments | |||
|- | |||
| 210 || SYBRGreen || -Control || Nothing Noticeable | |||
|- | |- | ||
| 211 || SYBRGreen || 2-1 || Nothing Noticeable | |||
|- | |||
| 212 || SYBRGreen || 2-2 || Nothing Noticeable | |||
|- | |||
| 213 || SYBRGreen || 2-3 || Nothing Noticeable | |||
|- | |||
| 214 || SYBRGreen || +Control || Very Green | |||
|- | |||
| 215 || SYBRGreen || 1-1 || Nothing Noticeable | |||
|- | |||
| 216 || SYBRGreen || 1-2 || Nothing Noticeable | |||
|- | |- | ||
| | | 217 || SYBRGreen || 1-3 || Nothing Noticeable | ||
|- | |- | ||
| 218 || SYBRGreen || Red || Very Green | |||
|-} | |||
<br> | |||
<br> | |||
'''Fluorimeter Procedure/Results - Step 2''' | |||
<br> | |||
This table correlates with DNA Sample Preparation table and shows how the patient's samples were testing using the fluorimeter. | |||
<br> | <br> | ||
<br> | <br> | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
! | ! Sample !! Area !! Mean Pixel Value<br>INTDEN !! RAWINTDEN !! INTDEN | ||
|- | |||
| Patient 1-Sample 1 || 21392 || 108.197 || 2314551 || 2314551 | |||
|- | |||
| Patient 1-Sample 2 || 32248 || 111.873 || 3607696 || 3607696 | |||
|- | |||
| Patient 1-Sample 3 || 35600 || 101.153 || 3601038 || 3601038 | |||
|- | |||
| Negative Control || 22928 || 150.115 || 3441833 || 3441833 | |||
|- | |- | ||
| | | Positive Control || 38596 || 219.663 || 8478127 || 8478127 | ||
|- | |- | ||
| Patient 2-Sample 1 || 19316 || 104.921 || 2026652 || 2026652 | |||
|- | |- | ||
| Patient 2-Sample 2 || 29968 || 133.532 || 4001694 || 4001694 | |||
|- | |- | ||
| | | Patient 2-Sample 3 || 29556 || 146.149 || 4319570 || 4319570 | ||
|- | |- | ||
| Red || 51028 || 235.047 || 11993985 || 11993985 | |||
|-} | |||
<br> | <br> | ||
<br> | |||
'''ImageJ Processing Results - Step 3''' | |||
<br> | |||
This is the raw data from taken from the photos using the ImageJ software. | |||
<br> | |||
<br> | |||
<!--- Place two small Image J data images here. One showing the result of Water and the other showing the result of Calf Thymus DNA ---> | |||
{| | |||
| [[Image:WaterImage13.JPG|thumb|upright|alt=Fluorimeter Water Sample|Sample Image of Water]] | |||
| [[Image:CalfThymusImage13.jpg|thumb|upright|alt=Fluorimter Calf Thymus DNA|Sample Image of Calf Thymus DNA]] | |||
|} | |||
<!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | <!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | ||
'''Final Results''' | |||
<br> | |||
{| {{table}} | {| {{table}} | ||
|- style="background:#f0f0f0;" | |- style="background:#f0f0f0;" | ||
| '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | | '''Sample''' || '''Integrated Density''' || '''DNA μg/mL''' || '''Conclusion''' | ||
|- | |- | ||
| PCR: Negative Control || 3367501 || 0 || | | PCR: Negative Control || 3367501 || 0 || Negative | ||
|- | |- | ||
| PCR: Positive Control || 8381066 || 1.193299682 || | | PCR: Positive Control || 8381066 || 1.193299682 || Positive | ||
|- | |- | ||
| PCR: Patient 1 ID #####, rep 1 || 2222463 || -0.266289229 || | | PCR: Patient 1 ID #####, rep 1 || 2222463 || -0.266289229 || Negative | ||
|- | |- | ||
| PCR: Patient 1 ID #####, rep 2 || 3515595 || 0.040183055 || | | PCR: Patient 1 ID #####, rep 2 || 3515595 || 0.040183055 || Negative | ||
|- | |- | ||
| PCR: Patient 1 ID #####, rep 3 || 3523638 || 0.042089246 || | | PCR: Patient 1 ID #####, rep 3 || 3523638 || 0.042089246 || Negative | ||
|- | |- | ||
| PCR: Patient 2 ID #####, rep 1 || 1944235 || -0.3322296265 || | | PCR: Patient 2 ID #####, rep 1 || 1944235 || -0.3322296265 || Negative | ||
|- | |- | ||
| PCR: Patient 2 ID #####, rep 2 || 3891599 || 0.129296003 || | | PCR: Patient 2 ID #####, rep 2 || 3891599 || 0.129296003 || Negative | ||
|- | |- | ||
| PCR: Patient 2 ID #####, rep 3 || 4210772 || 0.204940004 || | | PCR: Patient 2 ID #####, rep 3 || 4210772 || 0.204940004 || Negative | ||
|} | |} | ||
KEY | KEY | ||
* '''Sample''' = | * '''Sample''' = is the specfic amount of DNA from the population, which is a cancer patient. | ||
* '''Integrated Density''' = | * '''Integrated Density''' = is the total of the gray values of each pixel in a determined area. | ||
* '''DNA μg/mL''' = | * '''DNA μg/mL''' = was found by using the negative and positive controls to create a curve in which each of the integrated density values could be substituted for the x value in the curve equation. | ||
* '''Conclusion''' = | * '''Conclusion''' = tells us if the patient is positive or negative for the cancer gene. | ||
<!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | <!-- ##### DO NOT edit below this line unless you know what you are doing. ##### --> | ||
|} | |} | ||
Latest revision as of 20:31, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
THE A TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD display from the CPU, which caused the LCD display to lose power. We also unplugged the connection between the circuit board and the main heating block. After this connection was severed the LCD displayed a reading of -40 °C.
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine and cycled through 3 stages. The first stage is done at 95°C, in this stage the DNA double helix denatures into individual single strands. The second stage is dropped to 57°C where the primers anneal to the single strand of DNA in preparation for replication. The third and final stage reheats the sample to 72°C where TAQ polymerase copies all the DNA.
<http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg>
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.
ResultsThis table describes the procedural steps taken to prepare our samples for the fluorimeter.
Fluorimeter Procedure/Results - Step 2 This table correlates with DNA Sample Preparation table and shows how the patient's samples were testing using the fluorimeter.
ImageJ Processing Results - Step 3 This is the raw data from taken from the photos using the ImageJ software.
Final Results
KEY
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






