BME103:T930 Group 13: Difference between revisions
m →Results |
|||
| (18 intermediate revisions by 2 users not shown) | |||
| Line 143: | Line 143: | ||
'''Specific Cancer Marker Detection - The Underlying Technology'''<br> | '''Specific Cancer Marker Detection - The Underlying Technology'''<br> | ||
Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine | Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine and cycled through 3 stages. The first stage is done at 95°C, in this stage the DNA double helix denatures into individual single strands. The second stage is dropped to 57°C where the primers anneal to the single strand of DNA in preparation for replication. The third and final stage reheats the sample to 72°C where TAQ polymerase copies all the DNA. | ||
<br> | |||
<br> | |||
The success of reaction depends on whether or not the primers placed in the mixture match some segment on the DNA strand. In this case the primers match with the known r17879961 (CHEK2) cancer-related segment were placed into mixture with the DNA. Specifically the forward primer is: 3' TGGTATAAGACATTCCTGTC 5' and the reverse primer is: 5' AACTCTTACACTGCATACAT 3'. The reverse primer contains the specific SNP for this gene and the forward primer is 200 bp left of the reverse primer. The specific change in these primers occurs with the change from the typical CHEK2 gene at the 8,511,656 base pair (the 11th nucleotide in the reverse primer) where a thymine is replaced by a cytosine. <br> Therefore only DNA segments that match these primers will be amplified. | |||
<br> | |||
<br> | |||
This method of replicating DNA works by having the two primers anneal to different strands of DNA and replicating in one direction. This process leaves two partial strands of DNA which is not the target sequence, however, it does contain the target sequence. Over the next few cycles the other primer will anneal to the same strand of DNA (if the forward annealed to it first then the reverse will anneal to it and vice versa). After annealing it will copy in the other direction and end where the other primer started giving you the 200 base pair target sequence. Because only segments with the primers are amplified if the patient does not have this r17879961 single nucleotide polymorphism (SNP) the DNA will not be amplified. Therefore the positive result for having the r17879961 SNP is the presence of amplified DNA in the PCR reaction. A positive result was detected by using an image of the DNA dyed with Sybr green dye taken in a a black box. The concentration of DNA could be detected by measuring the amount of fluorescence in the picture. | |||
<br> | |||
<br> | |||
<br> | |||
'''Bayes Rule''' | |||
<br> | <br> | ||
<br> | <br> | ||
The Bayes rule is: p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}] | The Bayes rule is: p(C/T)= [p(T/C)*p(C)]/[{p(T/C)*p(C)}+{p(T/~C)*p(~C)}] | ||
| Line 183: | Line 192: | ||
|- | |- | ||
| Red || Red Dot || Red | | Red || Red Dot || Red | ||
|- | |-} | ||
'''DNA Sample Preparation - Step 1 | '''DNA Sample Preparation - Step 1'''<br> | ||
This table describes the procedural steps taken to prepare our samples for the fluorimeter. | This table describes the procedural steps taken to prepare our samples for the fluorimeter. | ||
<br> | <br> | ||
| Line 190: | Line 199: | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
! Image Number !! Drop 1 !! Drop 2 !! Comments | ! Image Number !! Drop 1 !! Drop 2 !! Comments | ||
|- | |- | ||
| Line 210: | Line 218: | ||
|- | |- | ||
| 218 || SYBRGreen || Red || Very Green | | 218 || SYBRGreen || Red || Very Green | ||
|- | |-} | ||
<br> | <br> | ||
<br> | <br> | ||
'''Fluorimeter Procedure/Results - Step 2''' | |||
<br> | <br> | ||
This table correlates with DNA Sample Preparation table and shows how the patient's samples were testing using the fluorimeter. | |||
<br> | <br> | ||
<br> | <br> | ||
{| border="1" class="wikitable" | {| border="1" class="wikitable" | ||
! Sample !! Area !! Mean Pixel Value<br>INTDEN !! RAWINTDEN !! INTDEN | ! Sample !! Area !! Mean Pixel Value<br>INTDEN !! RAWINTDEN !! INTDEN | ||
|- | |- | ||
| Line 240: | Line 247: | ||
|- | |- | ||
| Red || 51028 || 235.047 || 11993985 || 11993985 | | Red || 51028 || 235.047 || 11993985 || 11993985 | ||
|- | |-} | ||
'''ImageJ Processing Results - Step | <br> | ||
<br> | |||
'''ImageJ Processing Results - Step 3''' | |||
<br> | <br> | ||
This is the raw data from taken from the photos using the ImageJ software. | This is the raw data from taken from the photos using the ImageJ software. | ||
<br> | <br> | ||
<br> | <br> | ||
<!--- Place two small Image J data images here. One showing the result of Water and the other showing the result of Calf Thymus DNA ---> | |||
{| | |||
| [[Image:WaterImage13.JPG|thumb|upright|alt=Fluorimeter Water Sample|Sample Image of Water]] | |||
| [[Image:CalfThymusImage13.jpg|thumb|upright|alt=Fluorimter Calf Thymus DNA|Sample Image of Calf Thymus DNA]] | |||
|} | |||
<!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | <!--- Enter the values from your group's Data Analyzer table below. E6, F6, etc. are the excel cells from which you should copy your data. ---> | ||
'''Final Results''' | |||
<br> | |||
{| {{table}} | {| {{table}} | ||
|- style="background:#f0f0f0;" | |- style="background:#f0f0f0;" | ||
| Line 274: | Line 287: | ||
| PCR: Patient 2 ID #####, rep 3 || 4210772 || 0.204940004 || Negative | | PCR: Patient 2 ID #####, rep 3 || 4210772 || 0.204940004 || Negative | ||
|} | |} | ||
Latest revision as of 20:31, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
THE A TEAMLAB 1 WRITE-UPInitial Machine TestingThe Original Design
Experimenting With the Connections To test the machine and it's connectivity several simple tests were run. First we unplugged the LCD display from the CPU, which caused the LCD display to lose power. We also unplugged the connection between the circuit board and the main heating block. After this connection was severed the LCD displayed a reading of -40 °C.
Protocols
Research and DevelopmentSpecific Cancer Marker Detection - The Underlying Technology Polymerase Chain Reaction (PCR) works by adding primers, nucleotides, a catalyst, and a polymerase to a sample of DNA. Then the samples are placed in PCR machine and cycled through 3 stages. The first stage is done at 95°C, in this stage the DNA double helix denatures into individual single strands. The second stage is dropped to 57°C where the primers anneal to the single strand of DNA in preparation for replication. The third and final stage reheats the sample to 72°C where TAQ polymerase copies all the DNA.
<http://openwetware.org/images/1/1f/Acetic_acid_db.jpeg>
Pray, Leslie A., Ph.D. "The Biotechnology Revolution: PCR and the Use of Reverse Transcriptase to Clone Expressed Genes." Nature.com. Nature Publishing Group, 2008. Web. 15 Nov. 2012.
ResultsThis table describes the procedural steps taken to prepare our samples for the fluorimeter.
Fluorimeter Procedure/Results - Step 2 This table correlates with DNA Sample Preparation table and shows how the patient's samples were testing using the fluorimeter.
ImageJ Processing Results - Step 3 This is the raw data from taken from the photos using the ImageJ software.
Final Results
KEY
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||






