BME103:T130 Group 12: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(14 intermediate revisions by 4 users not shown)
Line 9: Line 9:
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->
<!-- ##### DO NOT edit above this line unless you know what you are doing. ##### -->


=OUR TEAM=
 


{| style="wikitable" width="700px"
{| style="wikitable" width="700px"
|- valign="top"
|- valign="top"
| [[Image:220px-Zach_Braff_2011_Shankbone.JPG|100px|thumb|Name: Justin Landstrom<br>Experimental Protocol Planner and ImageJ Software Processor]]
| [[Image:BME_103_PersonalPage.jpg|100px|thumb|Name: Justin Landstrom<br>Experimental Protocol Planner and ImageJ Software Processor]]
| [[Image:Cosby.jpg|100px|thumb|Name: Chiao May Lee<br>Experimental Protocol Planner and Data Compiler and Analyzer]]
| [[Image:Frontpagepicture.JPG|100px|thumb|Name: Chiao May Lee<br>Experimental Protocol Planner and Data Compiler and Analyzer]]
| [[Image:yaoming.jpg|100px|thumb|Name: James Kyeh<br>Open PCR Machine Engineer and DNA Measurement Operator]]
| [[Image:jameskyeh.jpg|100px|thumb|Name: James Kyeh<br>Open PCR Machine Engineer and DNA Measurement Operator]]
| [[Image:XZEGG.jpg|100px|thumb|Name: Jakob G. Wells<br>R&D Scientist]]
| [[Image:XZEGG.jpg|100px|thumb|Name: Jakob G. Wells<br>R&D Scientist]]
| [[Image:Photo.JPGf|100px|thumb|Name: Heidi Hall<br>Open PCR Machine Engineer and Protocol Person]]
| [[Image:Photo.JPGf|100px|thumb|Name: Heidi Hall<br>Open PCR Machine Engineer and Protocol Person]]
| [[Image:BME103student.jpg|100px|thumb|Name: student<br>Role(s)]]
|}
|}


Line 229: Line 228:


==Results==
==Results==
 
Below are the pictures that were put into ImageJ and used to gather data.
 
[[Image:bme103pics.jpg]]
<!--- Place two small Image J data images here. One showing the result of Water and the other showing the result of Calf Thymus DNA --->


{| {{table}}
{| {{table}}
Line 282: Line 280:
| '''Sample''' || '''INTDEN (drop)''' || '''INTDEN (background)''' || '''INTDEN with Background Subtracted''' || '''DNA μg/mL''' || '''Conclusion'''
| '''Sample''' || '''INTDEN (drop)''' || '''INTDEN (background)''' || '''INTDEN with Background Subtracted''' || '''DNA μg/mL''' || '''Conclusion'''
|-
|-
| Water || 3491003 || 466695 || 3014308 || None ||  
| Water || 3491003 || 466695 || 3014308 || None || --
|-
|-
| Calf Thymus DNA || 4107996 || 301733 || 3806263 || 2.0 ||
| Calf Thymus DNA || 4107996 || 301733 || 3806263 || 2.0 || --
|-
|-
| PCR: Negative Control || 4240449 || 717685 || 3522764 || 1.9 ||  
| PCR: Negative Control || 4240449 || 717685 || 3522764 || 1.9 || Positive
|-
|-
| PCR: Positive Control || 5859196 || 504846 || 5354332 || 2.8 ||
| PCR: Positive Control || 5859196 || 504846 || 5354332 || 2.8 || Positive
|-
|-
| PCR: Patient A ID 11014, rep 1 || 7570053 || 344912 || 7225141 || 3.8 ||  
| PCR: Patient A ID 11014, rep 1 || 7570053 || 344912 || 7225141 || 3.8 || Positive
|-
|-
| PCR: Patient A ID 11014, rep 2 || 4865678 || 256551 || 4609127 || 2.4 ||  
| PCR: Patient A ID 11014, rep 2 || 4865678 || 256551 || 4609127 || 2.4 || Positive
|-
|-
| PCR: Patient A ID 11014, rep 3 || 8107782 || 442441 || 7665341 || 4 ||  
| PCR: Patient A ID 11014, rep 3 || 8107782 || 442441 || 7665341 || 4 || Positive
|-
|-
| PCR: Patient B ID 46446, rep 1 || 10789693 || 750043 || 10039650 || 4.3 ||  
| PCR: Patient B ID 46446, rep 1 || 10789693 || 750043 || 10039650 || 4.3 || Positive
|-
|-
| PCR: Patient B ID 46446, rep 2 || 7616625 || 677576 || 6939049 || 3.6 ||  
| PCR: Patient B ID 46446, rep 2 || 7616625 || 677576 || 6939049 || 3.6 || Positive
|-
|-
| PCR: Patient B ID 46446, rep 3 || 5030472 || 513464 || 4517008 || 2.4 ||  
| PCR: Patient B ID 46446, rep 3 || 5030472 || 513464 || 4517008 || 2.4 || Positive
|}
|}


== KEY ==


KEY
* '''Sample''' = What the contents are of the sample being tested. There were 10 samples total: 8 samples from the OpenPCR instrument, 1 DNA sample and 1 water sample.
* '''Sample''' = What the contents are of the sample being tested. There were 10 samples total: 8 samples from the OpenPCR instrument, 1 DNA sample and 1 water sample.
* '''Rep''' = Repeat
* '''Rep''' = Repeat
* '''Drop''' =  The values obatined when you  draw the best oval around the (green) drop image and then select ANALYZE > MEASURE
* '''Drop''' =  The values obatined when you  draw the best oval around the (green) drop image and then select ANALYZE > MEASURE
* '''Background''' = The values obtained when you draw another oval of the same size in the (green) file for the background above the drop to get the “noise,"  and select ANALYZE > MEASURE
* '''Background''' = The values obtained when you draw another oval of approximately the same size in the (green) file for the background above the drop to get the “noise,"  and select ANALYZE > MEASURE
* '''INTDEN''' = Integrated Density
* '''INTDEN''' = Integrated Density
* '''Integrated Density''' = The sum of the values of the pixels in the selected part of the image. Since the image viewed was the green channel, the value of each pixel is the amount of green present in that pixel. We subtracted the INTDEN from the background of the image in order to eliminate any noise and get a more accurate result.
* '''Integrated Density''' = The sum of the values of the pixels in the selected part of the image. Since the image viewed was the green channel, the value of each pixel is the amount of green present in that pixel. We subtracted the INTDEN from the background of the image in order to eliminate any noise and get a more accurate result.
* '''DNA μg/mL''' = This column of estimated DNA concentrations was calculated using a proportional calibration based on the given values: water's subtracted INTDEN of 3014308 had 0μg/mL and the DNA CALF THYMUS with a subtracted INTDEN value of 3806263 has 2μg/mL of DNA.
* '''DNA μg/mL''' = This column of estimated DNA concentrations was calculated using a proportional calibration based on the given values: water's subtracted INTDEN of 3014308 had 0μg/mL and the DNA CALF THYMUS with a subtracted INTDEN value of 3806263 has 2μg/mL of DNA. The specific formula is x = 2.0  * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted.
* '''Conclusion''' = <!--- explain what "Positive" and "No signal" means, relative to the control samples --->
* '''Conclusion''' = A sample with a DNA concentration greater than that of our control is therefore positive. After noting that all of the samples were shown to have estimated DNA concentrations much higher than the DNA CALF THYMUS, it is clear that there was most likely a camera positioning error with the DNA CALF THYMUS which resulted in a INTDEn that was far too low.





Latest revision as of 20:39, 15 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help


Name: Justin Landstrom
Experimental Protocol Planner and ImageJ Software Processor
Name: Chiao May Lee
Experimental Protocol Planner and Data Compiler and Analyzer
Name: James Kyeh
Open PCR Machine Engineer and DNA Measurement Operator
Name: Jakob G. Wells
R&D Scientist
Name: Heidi Hall
Open PCR Machine Engineer and Protocol Person

LAB 1 WRITE-UP

Initial Machine Testing

The Original Design

The Open PCR machines is a DYI device that is composed of many circuit boards, wires, and a wooden frame. It is to be used to cycle DNA by oscillating the temperature of the DNA samples. This machine predominately works when the samples are placed in the main heating block, at which point a heated lid is placed down on top of the samples. Once the software for this Open PCR device is set up, the temperature change and the actual process begins. Within the Open PCR machine is a multitude of parts that keep the machine intact. These parts include a heat sink and fan to absorb heat, a circuit board that runs all the parts, a power supply to maintain the electricity, and a LCD display to show the user information. In conclusion, all of these parts work cohesively to generate this working machine known as the Open PCR.

Experimenting With the Connections
It is important to note that the LCD display will not work if it is not connected to the Open PCR circuit Board. Also, the temperature will not be shown on the LCD display if the white wire connecting to the main heating block is disconnected from the Open PCR circuit board.

Test Run The test run was done November 1st, 2012. Machine number 12 was used and there were minimal problems. It felt as if the machine was running slower than it should, but other than that all went well.



Protocols

Polymerase Chain Reaction

A polymerase chain reaction (PCR) is based on the enzyme DNA Polymerase's ability to synthesize complementary DNA strands. Through a series of steps involving polymerase breaking apart a DNA strand and then synthesizing a specified complementary piece, a PCR machine is able to isolate and amplify a desired strand of DNA.


Steps to Amplify a Patient's DNA Sample

1. PCR uses controlled temperature changes to make copies of DNA. Heat (about 95°C) separates double-stranded DNA into two single strands; this process is called denaturation.

2. "Primers", or short DNA strands, binds to the very end of the complimentary sequence that is being replicated. This step is called annealing, which takes place between 40°C and 65°C. The temperature that we used was 57°C.

3. Once the annealing process is done, the temperature is raised to about 72°C and DNA polymerase then extends from the primers copying the DNA.

4. PCR then amplifies a segment of a DNA sequence. In the end, there will be two new DNA strands identical to the original strand.


Components of PCR Master Mix

• A modified form of the enzyme Taq DNA polymerase that lacks 5´→3´ exonuclease activity.

• dNTPs

• MgCl2

• Colorless Reaction Buffer (pH 8.5)


Components of PCR Master Mix

Reagent Volume
Template DNA (20 ng) 0.2μL
10μM forward primer 1.0μL
10μM reverse primer 1.0μL
GoTaq master mix 50.0μL
dH2O 47.8μL
Total Volume 100μL


Sample 1: Patient ID: 11014 Age: 67 Gender: Male Replicate: 1

Sample 2: Patient ID: 11014 Age: 67 Gender: Male Replicate: 2

Sample 3: Patient ID: 11014 Age: 67 Gender: Male Replicate: 3

Sample 4: Patient ID: 46446 Age: 62 Gender: Female Replicate: 1

Sample 5: Patient ID: 46446 Age: 62 Gender: Female Replicate: 2

Sample 6: Patient ID: 46446 Age: 62 Gender: Female Replicate: 3

Sample 7: Positive Control

Sample 8: Negative Control


Flourimeter Assembly Procedure

1. To assemble the flourimeter, first obtain smartphone to capture the picture needed during data collection.

2. Turn on the flourimeter and drop a single drop of solution onto the hydrophobic slide.

3. Turn the black box provided upside down to cover the flourimeter.

4. Set up the smartphone on the stand provided, and align the camera/phone about 3 inches in front of the flourimeter. Make sure that the stand and the flourimeter is covered directly under the black box.


Proper assembly of the flourimeter.


Steps To Prepare Samples For The Flourimeter

You will have 8 samples from the OpenPCR instrument and 1 DNA (calf thymus standard at 2 micrograms/mL) sample and water from the scintillation vial to analyze.

1. With a permanent marker, number your transfer pipettes at the bulbs so that you only use if for one sample. With the permanent marker number your Eppendorf tubes at the top. At the end, you should have 10 Eppendorf tubes and 10 pipettes clearly labeled.

2. Transfer each sample seperatly (using one pipette per sample) into an Eppendorf tube containing 400 mL of buffer. Label this tube with the number of your sample. Get your entire sample into this Eppendorf tube. You can use this sample number transfer pipette to place only this sample drop onto the fluorescent measuring device.

3. Take the specially labeled Eppendorf tube containing Sybr Green I using the specifically labeled pipette only place two drops on the first two centered drops as seen on the video.

4. Now take your diluted sample and place two drops on top of the Syber Green I solution drops.

5. Align the light going through the drop, as seen in the video.

6. Let the smart-phone operator take as many pictures using the light box as he/she wants.

7. Now either rerun the sample again or discard that sample’s pipette. Keep the Sybr Green I labeled pipette.

8. You can run 5 samples per glass slide.

9. As the last sample run the water from the scintillation vial as a blank using the same procedure as with the other samples.


Procedure for Capturing Images of the Flourimeter with a Smartphone

Our group used a Galaxy Nexus

1. After setting up the Flourimeter set a Smartphone’s photo settings to the ones listed.

  1. Inactivate the flash
  2. Set ISO To 800 (or higher if possible)
  3. Set White Balance to Auto
  4. Set Exposure to Highest Setting
  5. Set Saturation to the Highest Setting
  6. Set Contrast to Lowest Setting

2. Once the samples have been prepared, place the Flourimeter in the light box.

3. Take as many pictures as needed. Your goal is to take pictures clear enough so ImageJ can take data from the images.

4. Once you have taken enough photos of that sample give the Flourimeter back to the sample preparer to prepare the next sample.

5. Repeat this procedure for all the samples.


A pure drop of water on the hydrophobic slide


Procedure for Opening Images in ImageJ

1. ImageJ was used to analyze the images taken by the smartphone. To upload the image onto ImageJ, the ANALYZE tab was clicked and SET MEASUREMENTS was chosen. AREA INTEGRATED DENSITY and MEAN GREY VALUE was selected from the menu.

2. The MENU tab was selected and COLOR was chosen, the function SPLIT CHANNELS was used; three separate files were created. SYBR GREEN fluoresces green, so the image name with "green" next to it was used.

3. The oval selection was used to draw an oval around the green drop. Then, MEASURE was selected from the ANALYZE tab, and the sample number and the numbers measured from the image were recorded.

4. To get the readings from the background of the image, another oval of approximately the same size was drawn in the background green image and MEASURE was selected from ANALYZE tab. The sample number and the numbers measured from the image was recorded, this data will be labeled as "background".

5. The measurements were saved in an excel file by clicking SAVED AS from the FILE tab.



Research and Development

Specific Cancer Marker Detection - The Underlying Technology

PCR detection works by heating the DNA sample to about 110°C in order to split the DNA. Then the PCR cools off to 57°C in order for the primer to attach to the DNA strands. The PCR then heats to 72°C so the DNA strand can be re-written. The rs17879961 cancer-associated sequence will produce a DNA signal because the reverse primer used, AACTCTTACACTCGATACAT(The letters in the sequence are the bases and stand for Guanine (G), Adenine (A), Cytosine (C), and Thymine (T). ) will only attach if the DNA sample has the same coding with the cancer-associated sequence “ACT”. If the DNA sample does not have the cancer-associated sequence the primer will not attach because the sequence is AACTCTTACACTTCGATACAT, and there will be no DNA signal. The primer sequences that will be used is ACTC or in reverse CTCA.

A positive result will be known because there will be a profound amount of the same sequence, the rs17879961. If there is none of the sequence than we know that the results are negative.


http://openwetware.org/images/3/39/Screen_Shot_2012-11-01_at_3.56.31_PM.png

Baye's Law (worksheet)

Basically Baye's Rule is that the results are not 100% accurate. Therefore, there will be some incorrect results. False positives and false negatives can occur often. Baye's Rule is what is used to find the false positive and false negative results. [IMG]http://i.imgur.com/XwQGA.png[/IMG] Source: http://openpcr.org/use-it/



Results

Below are the pictures that were put into ImageJ and used to gather data.

Sample Name Background ID Area X Y W H Mean Pixel Value Raw INTDEN INTDEN (if different)
Water (drop) 4 drops of Water 40090 900 1617 243 210 86.83 3481003 --
Water (Background) 4 drops of Water 40090 -- -- -- -- 11.641 466695 --
Calf Thymus DNA (drop) 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA 23060 765 1587 204 144 178.144 4107996 --
Calf Thymus DNA (background) 2 drops of Sybr Green I & 2 drops of Calf Thymus DNA 21712 -- -- -- -- 13.897 301733 --
PCR: Negative Control (drop) 2 drops of Sybr Green I & 2 drops of C- 53988 873 1809 276 249 78.544 4240449 --
PCR: Negative Control (background) 2 drops of Sybr Green I & 2 drops of C- 53988 -- -- -- -- 13.293 717685 --
PCR: Positive Control (drop) 2 drops of Sybr Green I & 2 drops of C+ 42819 687 1656 249 219 136.836 5859196 --
PCR: Positive Control (background) 2 drops of Sybr Green I & 2 drops of C+ 42819 -- -- -- -- 11.79 504846 --
PCR: Patient A ID 11014, rep 1 (drop) 2 drops of Sybr Green I & 2 drops of 1A 32840 849 1626 258 165 230.513 7570053 --
PCR: Patient A ID 11014, rep 1 (background) 2 drops of Sybr Green I & 2 drops of 1A 32872 -- -- -- 10.493 344912 --
PCR: Patient A ID 11014, rep 2 (drop) 2 drops of Sybr Green I & 2 drops of 2A 24996 780 1674 204 156 194.658 4865678 --
PCR: Patient A ID 11014, rep 2 (background) 2 drops of Sybr Green I & 2 drops of 2A 23568 -- -- -- -- 10.886 256551 --
PCR: Patient A ID 11014, rep 3 (drop) 2 drops of Sybr Green I & 2 drops of 3A 34832 852 1743 231 192 232.768 8107782 --
PCR: Patient A ID 11014, rep 3 (background) 2 drops of Sybr Green I & 2 drops of 3A 34356 -- -- -- -- 12.878 442441 --
PCR: Patient B ID 46446, rep 1 (drop) 2 drops of Sybr Green I & 2 drops of 1B 62026 687 2013 342 231 173.954 10789693 --
PCR: Patient B ID 46446, rep 1 (background) 2 drops of Sybr Green I & 2 drops of 1B 62872 -- -- -- -- 11.930 750043 --
PCR: Patient B ID 46446, rep 2 (drop) 2 drops of Sybr Green I & 2 drops of 2B 46912 789 1797 252 237 162.36 7616625 --
PCR: Patient B ID 46446, rep 2 (background) 2 drops of Sybr Green I & 2 drops of 2B 46265 -- -- -- -- 14.646 677576 --
PCR: Patient B ID 46446, rep 3 (drop) 2 drops of Sybr Green I & 2 drops of 3B 40980 771 1734 252 207 122.754 5030472 --
PCR: Patient B ID 46446, rep 3 (background) 2 drops of Sybr Green I & 2 drops of 3B 40980 -- -- -- -- 12.530 513464 --
Sample INTDEN (drop) INTDEN (background) INTDEN with Background Subtracted DNA μg/mL Conclusion
Water 3491003 466695 3014308 None --
Calf Thymus DNA 4107996 301733 3806263 2.0 --
PCR: Negative Control 4240449 717685 3522764 1.9 Positive
PCR: Positive Control 5859196 504846 5354332 2.8 Positive
PCR: Patient A ID 11014, rep 1 7570053 344912 7225141 3.8 Positive
PCR: Patient A ID 11014, rep 2 4865678 256551 4609127 2.4 Positive
PCR: Patient A ID 11014, rep 3 8107782 442441 7665341 4 Positive
PCR: Patient B ID 46446, rep 1 10789693 750043 10039650 4.3 Positive
PCR: Patient B ID 46446, rep 2 7616625 677576 6939049 3.6 Positive
PCR: Patient B ID 46446, rep 3 5030472 513464 4517008 2.4 Positive

KEY

  • Sample = What the contents are of the sample being tested. There were 10 samples total: 8 samples from the OpenPCR instrument, 1 DNA sample and 1 water sample.
  • Rep = Repeat
  • Drop = The values obatined when you draw the best oval around the (green) drop image and then select ANALYZE > MEASURE
  • Background = The values obtained when you draw another oval of approximately the same size in the (green) file for the background above the drop to get the “noise," and select ANALYZE > MEASURE
  • INTDEN = Integrated Density
  • Integrated Density = The sum of the values of the pixels in the selected part of the image. Since the image viewed was the green channel, the value of each pixel is the amount of green present in that pixel. We subtracted the INTDEN from the background of the image in order to eliminate any noise and get a more accurate result.
  • DNA μg/mL = This column of estimated DNA concentrations was calculated using a proportional calibration based on the given values: water's subtracted INTDEN of 3014308 had 0μg/mL and the DNA CALF THYMUS with a subtracted INTDEN value of 3806263 has 2μg/mL of DNA. The specific formula is x = 2.0 * sample INTDEN with background subtracted / calf thymus INTDEN with background subtracted.
  • Conclusion = A sample with a DNA concentration greater than that of our control is therefore positive. After noting that all of the samples were shown to have estimated DNA concentrations much higher than the DNA CALF THYMUS, it is clear that there was most likely a camera positioning error with the DNA CALF THYMUS which resulted in a INTDEn that was far too low.