BME103:T130 Group 4 l2: Difference between revisions
Brent Russon (talk | contribs) |
Brent Russon (talk | contribs) |
||
| Line 81: | Line 81: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
<br> | |||
The marker that is being used is rs137852453. This SNP is associated with hemophiia. Hemophilia is a condition where someone's blood is not clotting properly. Data on this particular SNP variance can be seen here: <br> | |||
http://www.ncbi.nlm.nih.gov/projects/SNP/snp_ref.cgi?rs=137852453 <br> | |||
The associated gene change goes from a '''C'''GG (healthy gene sequence) to '''T'''GGG (sequence associated with hemophilia). | |||
The gene alteration leads to a mutated human protein. It goes from R[Arg] to W[Trp] | |||
'''Primer Design''' | |||
''' | <!--- Include the sequences of your forward and reverse primers. Explain why a disease allele will give a PCR product and the non-disease allele will not. ---><br> | ||
Bottom Primer (in reverse): <br> | |||
TGGAATTGG '''T''' GGGTGGAAT | |||
<br> | |||
Top Primer (forward): <br> | |||
TTCAAAGCTTCAAGTATATC <br> | |||
These primers will attach to the other half of the DNA, but only if there is a matching genetic code for them to attach to. The top primer should always have a matching pair to attach to because there should be no genetic variance in its counterpart while the bottom primer will only match up with its corresponding strand of DNA if the genetic variance is present. A Taq DNA polymerase then connects to any attached primers, which along with MgCl<sub>2</sub>, makes it possible for free-floating nucleotides to fill in the rest of the letters missing from the DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and the reproduction of DNA will not show a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially. <br> | |||
Revision as of 23:04, 15 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features
Instructions
ProtocolsMaterials
PCR Protocol
Research and DevelopmentBackground on Disease Markers
Primer Design
Illustration
| |



