BME103:W930 Group7 l2: Difference between revisions
Frea Mehta (talk | contribs) |
Frea Mehta (talk | contribs) |
||
| Line 141: | Line 141: | ||
<!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | <!--- Bonus: explain how Bayesian statistics can be used to assess the reliability of your team's method. Just write the equation using variables that are relevant to your team's new test. You do not need actual numbers ---> | ||
[[Image:BME103 anencephaly.jpg|thumb|frame|left|An anencephalactic fetus]] | |||
'''Background on Disease Markers''' | '''Background on Disease Markers''' | ||
Revision as of 05:35, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | |||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski. System Design
Key Features
Instructions
ProtocolsMaterials
Research and Development![]() Background on Disease Markers The two diseases we decided to analyze are Alzheimer's and Anencephaly. Alzheimer's disease is a form of dementia that affects the brain by gradually deteriorating an individual's brain function, leading to memory loss and impairing cognitive skills. The gene responsible for Alzheimer's is labeled PSEN1 and a mutation in this gene can cause toxic protein to build up in the brain leading to symptoms described above. The gene is found on chromosome 14 and the reference number for this gene is rs63751320. The allele sequence is GCTCATCTTGGCTGTGATTTCAGTAT[A/C]TGGTAAAACCCAAGACTGATAATTT. For more information on this gene can be found on this link. [1]
The SNP associated with Meckel syndrome is rs121918202, the gene sequence for this SNP is ATGTAATTTTATTTTCATTTTAGCTG[C/T]AGGATAGAATTAATGATTTAGAAAA Forward Primer: taatatgtaattttattttcattttagctg Reverse Primer: gttaattttctaaatcattaattctatcct
Alzheimer- Alleles: [A/C] Forward Primer:5'CGTGGCTCATCTTGGCTGTGATTT3' Reverse Primer:3'CCCGACACTAACCTCGTCTAACAC5' The disease allele, in this case C, will give a PCR product because the PCR detects the specific allele difference or mutation and gives a positive reading. Since the PCR detects the specific allele mutation, a non-disease allele will not produce a product.
| |||||||||||||||||||||||||||||||||||






