BME103:W930 Group10 l2: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
Line 36: Line 36:


'''Key Features'''<br>
'''Key Features'''<br>
The design includes a color coordinated tray and a larger size in order to make Open PCR easier for a class of students.  
<b>PCR Block:</b>
The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray.
Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate
 
<b>Heat Sink/Fan:</b>
These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes.
Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.  
 
 





Revision as of 06:27, 28 November 2012

BME 103 Fall 2012 Home
People
Lab Write-Up 1
Lab Write-Up 2
Lab Write-Up 3
Course Logistics For Instructors
Photos
Wiki Editing Help

OUR TEAM

Name: Susan Sajadi
Role(s)
Name: Rachel Lundeen
Role(s)Research and Development
Name: Elizabeth Lopez
Role(s)
Name: Britny Sepulveda
Role(s)
Name: Raymond Feliciano
Role(s)
Name: Colin Siguenza
Role(s)
Name: Rotem Beger
Role(s)
Name: Lars Moss
Role(s)

LAB 2 WRITE-UP

Thermal Cycler Engineering

Our re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.


System Design


Key Features
PCR Block: The new design will be much larger, to include as many samples as possible to accomodate a standard classroom size. This includes a color coordinated tray. Benefit and Function- The color coordination will make it easier to keep track of the samples. The larger size will allow more students to participate

Heat Sink/Fan: These pieces will be enlarged accordingly with the other parts of the device as necessary for the additional samples. The placement may also be shifted for this accommodation with smaller class sizes. Benefit and Function: Since this device is aimed at being educational, an important factor is price. It will be cheaper to use a larger device to accomodate more students.



Instructions





Protocols

Materials


PCR Protocol



DNA Measurement Protocol



Research and Development

Background on Disease Markers


There are two diseases that our group decided to look into. The first disease is type II diabetes, which is the most common of the diabetes. The body does not produce enough insulin, which regulates the use of glucose, therefore leading to high levels of glucose in the blood. There is a mutation in the third chromosome which causes this disease. The SNP related to this is rs4402960 [1]. The second disease is insomnia. This is a sleeping disorder in which a person cannot fall asleep or stay asleep for as long as they would like. It is caused by a mutation in the twentieth chromosome. The SNP related to this is rs74315403 [2].


Primer Design


Forward Primer for Type 2 Diabetes:
GGACAGTAGATT[G/T]AAGATACTGATTGTGTTTGCAAACA
Reverse Primer for Type 2 Diabetes:
GGGCATGTTTGCAAACACAATCAGTATCTTAATCTACTGTCC
Forward Primer for Insomnia:
ACAGCAACCAGAACAACTTTGTGCAC[A/G]ACTGCGTCAATATCACAATCAAGCA
Reverse Primer for Insomnia:



Illustration