BME103:W930 Group8 l2: Difference between revisions
| (3 intermediate revisions by 2 users not shown) | |||
| Line 70: | Line 70: | ||
Thermal pad<br> | Thermal pad<br> | ||
'''1'''.Snap one of the pieces into the top piece<br> | '''1'''.Snap one of the side pieces into the top piece<br> | ||
'''2'''.Slide the metal nut into the cross section <br> | '''2'''.Slide the metal nut into the cross section <br> | ||
'''3'''.Slide Metal 16mm screw through the hole on the top piece<br> | '''3'''.Slide Metal 16mm screw through the hole on the top piece<br> | ||
| Line 83: | Line 83: | ||
'''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br> | '''12'''.Screw hinge to the back of the larger heated lid with black metal 8mm screws<br> | ||
'''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br> | '''13'''.Screw all four shoulder bolts into the underside of the heated lid.<br> | ||
'''14'''.Thread and wires through hole in back of the heated lid.<br> | '''14'''.Thread and connect wires through hole in back of the heated lid.<br> | ||
'''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br> | '''15'''.Attach larger lid casing to larger heated lid using four black metal 8mm screws<br> | ||
'''16'''.Screw heated lid handle into top of the lid<br> | '''16'''.Screw heated lid handle into top of the lid<br> | ||
| Line 192: | Line 192: | ||
<!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | <!--- A description of the diseases and their associated SNP's (include the database reference number and web link) ---> | ||
One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur | One gene we're choosing to examine is a gene that is linked to Alzheimer's Disease, which is a neurodegenerative disorder. Alzheimer's occurs by the misfolding of proteins, which result in clusters and aggregates of these misfolded proteins. Thus, proper function does not occur resulting in degeneration of neural cells, causing memory loss and other symptoms of Alzheimer's. The specific gene is [http://omim.org/entry/104760#0022 rs193922916]. The sequence for this gene is: | ||
<br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT. | <br><center> GGAGATCTCTGAAGTGAAGATGGATG'''[C/T]'''AGAATTCCGACATGACTCAGGATAT. | ||
</center> | </center> | ||
| Line 202: | Line 202: | ||
<center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center> | <center> AGAGCTTGTAGGGAAAGGAAAACGCC['''A'''/G]TCCTTTGAATAACAATTCTGAAATT.</center> | ||
The specific disease name for this SNP is sporadic prostate cancer | The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer. | ||
Latest revision as of 18:42, 28 November 2012
| Home People Lab Write-Up 1 Lab Write-Up 2 Lab Write-Up 3 Course Logistics For Instructors Photos Wiki Editing Help | ||||||||||||||||||||||||||||||||||||||||
OUR TEAMLAB 2 WRITE-UPThermal Cycler EngineeringOur re-design is based upon the Open PCR system originally designed by Josh Perfetto and Tito Jankowski.
Key Features Heated Lid/PCR Block: Heat Sink/Fan: LCD Screen: Instructions 1.Snap one of the side pieces into the top piece Heat Sink/Fan LCD Screen/PCR Board
ProtocolsMaterials for PCR
Materials For DNA Measurement
DNA Measurement Protocol (Flourimeter Protocol) To use the flourimeter in order to obtain DNA measurements, a set of steps were followed. First, the machine was set up. The device used to take photographs of the DNA, a phone, was set in place. The flourimeter was lined up in a position so that accurate photographs of the drops could be taken. A glass slide was put in place on the flourimeter so that light would be able to reach the sample and pass through it. A single drop of the DNA sample was then placed onto a slide. It is important to note that each drop (of each sample) was placed on the slide separately (one at a time). From there, the green dye (GoTaq Master Mix) was added. A photo was taken of the first DNA sample. The sample was removed and disposed of properly before the next sample was put in place on the slide. The slide was moved slightly so that the drop would not be contaminated with the DNA from the previous sample. For each sample, two drops of green dye were added and a photo was taken. this process was repeated until an image was taken of every sample. Note that it was important to keep track of which photo was of which sample. Image J Protocol The images from the device were then uploaded onto a computer that was enabled with Image J software. These photos were uploaded into the Image J program and the DNA samples were analyzed and measured. Analysis included using the software to split the color channels into three criteria. The green channel is used for measurement and analysis of the drop sample. Research and DevelopmentBackground on Disease Markers
There are many different SNP's for the Prostate Cancer Gene. This is shown in OMIM database reference number 176807. The sequence for this phenotype is: The specific disease name for this SNP is sporadic prostate cancer, located on the 22nd chromosome with the Gene ID CHEK 2. The allele change is a G to an A in the positions 614 or 743. This change in the allele leads to an argine to histidine protein residues. This leads to an early onset prostate cancer.
For our first gene dealing with Alzheimer's, the primer design would be:
The second primer design would be: Forward Primer Reverse Primer Both are within the accepted bp primer length (18-22), follows the GC clamp rule (G or C within 5 bp of 3' to clamp the primer down), and have an annealing temperature of 61 degrees Celsius forward and 53 degrees Celsius backward. These all show that the primers forward and backward for this strand above would work. The primer also contains the mutation from the DNA sequence. This would be why the PCR product would give show a cancer gene if there was one, due to the cancerous allele being present. If the non-disease allele were present, the primer would not bind and thus would not amplify.
Illustration
![]() Prostate Cancer PCR Illustration
| ||||||||||||||||||||||||||||||||||||||||









